BIOL368/S20:Sahil Patel Week 5

From OpenWetWare
Jump to navigationJump to search

Purpose

The purpose of this assignment is to critically reflect on the dataset from Markham et al (1998) to propose a hypotheses and a set of questions and to develop ways to quantify and visualize sequence similarity and differences.

Methods/Results

Activity 1: Looking at the NCBI Resources and HIV sequence data

Part 1: PubMed

  • How did you search for the PubMed entry?
    • I searched for the PubMed entry by entering the title of the article in the PubMed search bar and found the article right away since it was at the top.
  • What other ways might you have searched?
    • I could have done a google scholar search and typed in keywords such as "PubMed", "Markham et. al", and "HIV-1".
  • What other types of related information are available?
    • Other types of related information include MedGen, References for the article, Taxonomy via GenBank, Protein info, additional links to articles cited.

Part2: GenBank

  • What was the accession number of the sequence you chose?
    • AF016768
  • Which subject of the study was that HIV sequence from?
    • Subject 1
  • Which section of the record contains information about who the HIV was collected from?
    • The title includes the information of the subject relative to the trial as well as country of origin.

Part 3: Introduction to Phylogeny.fr

  • Go to www.phylogeny.fr and go to section phylogeny analysis on one click
  • Upload 5 FASTA text file of the sequences
  • Click on Alignment in Clustal format to view in text-only format:

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

AF089133.1      GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
AF089132.1      GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
AF089134.1      GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
AF016767.2      GGGGTAGTAATTAGATCCGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
AF016768.2      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACGGCTG
AF089133.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089132.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089134.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF016767.2      AATGAATCTGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016768.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF089133.1      CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
AF089132.1      CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF089134.1      CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF016767.2      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
AF016768.2      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
AF089133.1      CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF089132.1      CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF089134.1      CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF016767.2      TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
AF016768.2      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF089133.1      AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
AF089132.1      AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
AF089134.1      AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
AF016767.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
AF016768.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA

SP Phylogenetic Tree Week 5.png

Activity 2: Looking at the sources of HIV across subjects

Part 1: Looking at clustering across subjects

  • Download the files found on openwetware
  • Generate a multiple sequence alignment and distance tree for 12 of these sequences (3 clones from each of 4 subjects)
Table 2
Subject Clone #
6 1
2
3
7 1
2
3
8 1
2
3
9 1
2
3

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S8V1-3          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V1-1          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V1-2          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S9V1-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V1-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S7V1-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V1-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-2          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S8V1-3          AATGAATCTGTAGAGATGAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATATCT
S8V1-1          AATGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
S8V1-2          AATGAATCTGTAGAGATGAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATATCT
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S9V1-2          AAAGAACATGTAGAAATAAATTGTGCAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S7V1-3          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V1-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-2          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACTT
S8V1-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S8V1-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S8V1-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V1-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S7V1-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGGAATATAAGACAAGCA
S7V1-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S8V1-3          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V1-1          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V1-2          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S9V1-2          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAGATTA
S9V1-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S7V1-3          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S8V1-3          AGAGAACAATTTAAGAATAAAACAACAGTCTTTAATCAATCCTCA
S8V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S8V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S9V1-2          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-3          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-1          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S7V1-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-2          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA

Phylo tree week 5 activity 2 .png

  • Do the clones from each subject cluster together?
    • Yes, clones of the same subject cluster together on the tree.
  • Do some subjects' clones show more diversity than others?
    • Subjects 6,7, and 8 all show equal diversity, whereas Subject 9 showed the least amount of diversity.
  • Do some of the subjects cluster together?
    • No, neither of the 4 subjects cluster with one another.
  • Subjects in the phylogenetic tree are independent of one another, while clones cluster to each other. Subjects will likely not ever cluster together as further mutations occur because there is enough of a similarity among clones to offset the potential similarities between subjects.

Part 2: Quantifying diversity within and between subjects

  • Select all the clones of a subject and align them using phylogeny.fr
    • Download data from Nucleotide Sequence Data linked on openwetware
  • Calculate S by counting the number of positions where there is at least one nucleotide difference across the collection of clones (count the spaces between the * below nucleotide sequences)
  • Run the same analysis for two more subjects
  • Then calculate theta, which is an estimate of the average pairwise genetic distance

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment: Subject 9

S9V7-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGATAATGCTAAAACCATAATAGTACAGCTG
S9V7-8          GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-9          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-10         GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V7-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V6-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V6-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V6-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGTTG
S9V6-8          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGTTG
S9V6-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAACTG
S9V6-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAACTG
S9V4-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-2          GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-11         GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-8          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V6-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V6-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-10         GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-8          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V4-9          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V1-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V5-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-9          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V2-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V2-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V2-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-2          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V2-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V2-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V3-8          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V8-1          GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S9V8-4          GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S9V8-5          GAGGTAGTGCTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V8-2          GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S9V8-3          GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V8-6          GAGGTAGTGCTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V8-7          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V8-8          GAGGTAGTGGTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACGGCTG
                ********* ******************** * ******************** *   **
S9V7-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAGCAACAATACAAGAAAAAGTATAAAT
S9V7-8          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-7          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-9          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT
S9V7-10         AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V7-6          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-2          AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-5          AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-8          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT
S9V6-7          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT
S9V4-6          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-11         AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-7          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-6          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-8          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAACACAAGAAAAAGTATAAAT
S9V4-7          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S9V5-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V6-6          AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-10         AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-8          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V4-9          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-4          AAAGAACATGTAGAAATAAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-9          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-7          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-2          AAAGAACATGTAGAAATAAATTGTGCAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-6          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V2-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAGCAACAATACAAGAAAAAGTATAAAT
S9V2-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V2-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V2-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V2-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-4          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V3-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAGTACAAGAAAAAGTATAAAT
S9V3-8          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-4          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-3          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAGGAAAAAGTATACAT
S9V8-6          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S9V8-7          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V8-8          AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
                ***** ****** **********  ********* *****  *** *** *******  * 
S9V7-2          ATAGGACCAGGAAGAGCATTTTATGCAACAGGAGAAATAATAGGAGACATAAGACAAGCA
S9V7-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATACGACAAGCA
S9V7-3          ATAGGACCAGGAAGAGCATTTTATGCAACAGGAACAATAATAGGGGATATACGACAAGCA
S9V7-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-9          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-10         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V7-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V6-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V6-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V6-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V6-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V6-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V6-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAGGCA
S9V4-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V5-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V4-11         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V5-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGGGAAATAATAGGAGATATAAGACAAGCA
S9V5-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGGCAAGCA
S9V5-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V6-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V5-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V5-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGACAAGCA
S9V5-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAGGCA
S9V6-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V3-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCC
S9V4-10         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V4-9          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V5-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V5-9          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V3-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGACAAGCA
S9V1-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V2-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V2-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V2-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V2-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V2-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V3-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V8-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-7          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S9V8-8          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
                *********** ********************   *********  * *** * ** ** 
S9V7-2          CATTGTAACATTAGTAGAACAAAATGGAATGAGACCTTAAGACAGATAGTAGAAAAATTA
S9V7-4          CATTGTAACATCAGTGGAGCAAAATGGAATGAGACCTTAAAACAGATAGCTAAAAAATTA
S9V7-1          CATTGTAACATCAGTGGAACAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V7-3          CATTGTAACATCAGTGGAACAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V7-5          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGGAAAATTA
S9V7-8          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGGAAAATTA
S9V7-7          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGGAAAATTA
S9V7-9          CATTGTAACATTAGTGGAACAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA
S9V7-10         CATTGTAACATTAGTGGAACAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA
S9V7-6          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA
S9V6-2          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA
S9V6-5          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGGAAAATTA
S9V6-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA
S9V6-8          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGAAAAATTA
S9V6-4          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V6-7          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V4-6          CATTGTAATATTAGTGGAGCAAAATGGAATAACACATTAAAACAGACAGCTGAAAAATTA
S9V5-2          CATTGTAACGTTAGTGGAGCAAAATGGCATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V4-11         CATTGTAATATTAGTGGAGCAAAATGGCATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V4-2          CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAACTA
S9V5-7          CATTGTAACATTAGTGGAACAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-6          CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-8          CATTGTAACATTAGTGGAACAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V6-1          CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-4          CACTGTAACATTAGTGGAGTAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-5          CATTGTAACATTAGTGGAGTAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA
S9V4-5          CACTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA
S9V4-7          CATTGTAATATTAGTGGAGCAAAATGGAATGGCACCTTAAAACAGATAGTTGAAAAATTA
S9V5-3          CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V6-6          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V4-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA
S9V4-4          CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA
S9V4-3          CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA
S9V4-10         CATTGTAATATTAGTGGAGCAAAATGGAATGGCACCTTAAAACAGATAGTTGAAAAATTA
S9V4-8          CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V4-9          CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-5          CATTGTAACATTAGTGGAGCAAAATGGAAGGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-4          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-9          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-7          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-2          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAGATTA
S9V3-6          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCCTAAAACAGATAGTTGAAAAATTA
S9V2-2          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V2-3          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V2-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-2          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V2-5          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V2-4          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-4          CATTGTAACATTAGTGGGGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-5          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA
S9V3-8          CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAACTA
S9V8-1          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-4          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-5          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-2          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-3          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-6          CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA
S9V8-7          CATTGTAATATTAGTAGAGGAAAATGGAATAACACCTTAAAACAGATAGTTAAAAAATTA
S9V8-8          CATTGTAATATTAGTAGAACAAAATGGAATAACACCTTAAAACAGATAGTTAAAAAATTA
                ** *****  * **  *   ******* *    **  **  ***** **    ** * **
S9V7-2          AGAGAACAATTTAGAAATAAAATAATAATCTTTAATCACTCCTCA
S9V7-4          AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-1          AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-3          AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-5          AAAGAACAATTTGGGAATAAAATAATAATCTTTAATCACTCCTCA
S9V7-8          AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-7          AGAGAACAATTTGGAAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-9          AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-10         AAAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA
S9V7-6          AGAAAACAATTTAGCAATAAAATAATAGTCTTTAATCACTCCTCA
S9V6-2          AGAGAACAATTTCAGGATAAAACAATAGTCTTTAATCACTCCTCA
S9V6-5          AGAGAACAATTTCAGAATAAAATAATAGTCTTTAGTCACTCCTCA
S9V6-3          AGAGAACAGTTTCATGATAGAACAATAATCTTTAATCACTCCTCA
S9V6-8          AGAGAACAATTTCATAATAAAACAATAATCTTTAATCACTCCTCA
S9V6-4          AGAAAACAATTTCAGGATAAAACAATAATCTTTAATCACTCCTCA
S9V6-7          AGAAAACAATTTCAGGATAAAACAATAATCTTTAATCACTCCTCA
S9V4-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-2          AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V4-11         AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V4-2          AAAGAACAATTTAAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V5-7          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-6          AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-8          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V6-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-5          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V4-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V4-7          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-3          AAAGAACAATTTCAGAATAAAATAATAGTCTTTAATCACTCCTCA
S9V6-6          AGAGAACAATTTCAGAATAAAACAATAATCTTTAATCACTCCTCA
S9V3-3          AGAGAACAATTTCAGAATAGAACAGTAGTCTTTAATCACTCCTCA
S9V3-1          AAAGAACAATTTCAGAATAAAACAGTAGTCTTTAATCACTCCTCA
S9V4-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V4-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V4-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V4-10         AGAGAACAATTTAAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V4-8          AGAGAACAATTTAAGAATAGAATAATAGTCTTTAATCACTCCTCA
S9V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V1-5          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-4          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-1          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-9          AAAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V3-7          AGAGAACAATTTGAGAATAGAACAATAGTCTTTAATCACTCCTCA
S9V1-2          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V3-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V2-2          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V2-3          AGAGAACAATTTGAGAATAAAATAATAGTCTTTAATCACTCCTCA
S9V1-1          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V2-1          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V3-2          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V2-5          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-3          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V2-4          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V3-4          AGAGAACAATTTCATAATAAAACAGTAGTCTTTAATCACTCCTCA
S9V3-5          AGAGAACAATTTAAGAATAAAACAGTAGTCTTTAATCACTCCTCA
S9V3-8          AGAGAACAATTTAAGAATAGAACAGTAGTCTTTAATCACTCCTCA
S9V8-1          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCCCA
S9V8-4          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA
S9V8-5          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA
S9V8-2          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA
S9V8-3          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA
S9V8-6          AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA
S9V8-7          AGAGAACAATTT---AATAAAACAATAGTCTTTAATCACTCCTCA
S9V8-8          AGAGAACAATTT---AATAAAACAATAGTCTTTAATCACTCCTCA
                * * **** ***     ** ** * ** ****** ******* **

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment: Subject 4

S4V2-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-16         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-17         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-14         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-18         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-8          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-2          GAGGTTGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-5          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-9          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-6          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-12         GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-15         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-12         GAGGTAGTAGTTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAACAGTACAGCTG
S4V2-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
                ***** *** *************  **** *** *************** **********
S4V2-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACCT
S4V4-4          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V3-16         AATAAATCTGTAGGAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V4-13         AATGAATCTGTAGAAATTAATTGTACAAGACCTGACAACCATACAGTAAGAAAGATACCT
S4V3-17         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAGTATACCT
S4V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACGAAGAAGTATACCT
S4V3-14         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACAT
S4V3-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-10         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-13         AATGAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-18         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACACGACAACAATACAGTAAGAAAGATACCT
S4V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V1-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-1          AATAAATCTGTAGAAATCAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V4-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAATAAGAAGGATACCT
S4V2-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V3-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAAGATACCT
S4V4-1          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACAATACAGTAAGAAAGATACCT
S4V4-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-15         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACCATACAGTAAGAAAGATACCT
S4V2-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V2-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-13         AATGAATCGGTAGAAATTAATTGTACAAGACCCAACAACCATACAATAAGAAAGATACCT
S4V2-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAGGATACCT
S4V2-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V3-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACACCAATACAGTAAGAAAGATACCT
S4V2-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
                *** ****  *** *** *************   **  * *****  ** **  **** * 
S4V2-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAAAAAATATAAGGCAAGCACAT
S4V4-4          ATAGGACCCGGCAGAGCATTTTATACAACAGGCAGAATAGGCAATATAAGGCAAGCTCAT
S4V3-16         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGCGATATAAGGCAAGCACAT
S4V4-13         ATAGGACTAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V3-17         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGACATAAGGCAAGCACAT
S4V2-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-14         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-18         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V4-8          ATAGGACCAGGGAGTTCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V4-2          ATAGGACCAGGGAGATCATTTTATACAACAGGCATAGTAGGAGATATAAGGCAAGCACAT
S4V3-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-11         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGTAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-5          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V4-10         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCTCAT
S4V1-3          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V1-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V4-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAAATATAAGGCAAGCACAT
S4V2-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-11         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V1-2          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-2          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V3-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V4-1          ATAGGACCCGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-4          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-6          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-11         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-12         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-9          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V3-1          ATAGGACCAGGGAGTTCATCTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-15         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-3          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-2          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-4          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
                *******  ** **  *** ************   * **    * ******* *** ***
S4V2-6          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAAA
S4V4-4          TGTAACATTATTGAAGCAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-16         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGTTAACAAATTAAGA
S4V4-13         TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-17         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-14         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-18         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-8          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-2          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGCTAACAAATTAAGA
S4V3-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-11         TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-5          TGTAACATTAGTAAAACAAAACGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V1-3          TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGTTAACAAATTAAGA
S4V1-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-11         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGG
S4V1-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V3-4          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V4-11         TGTAACATTAGTAGAACAAAATGGAACAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-15         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V2-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-4          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
                ********** *  * ***** **** *** ********** ** * ***********  
S4V2-6          AAACAATTTAAAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-4          GAACAGTTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-16         GAACAATTTAGGAATAAAACAATAATCTTTAGTCAATCCCCA
S4V4-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-17         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-14         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-8          GAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S4V3-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-18         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-8          GAACAATTTAGAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-5          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-11         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-5          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-10         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-1          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-11         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-2          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-5          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-3          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-1          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-4          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-11         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-1          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-15         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA 
S4V3-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-12         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-1          GAACAATTTAGGAATGAAACAATAATCTTTAATCAATCCTCA
S4V2-13         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAA-CCTCA
S4V2-8          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-2          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-4          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
                 **** ***   *** ******** ****** **** ** **

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment: Subject 13

S13V4-1         GAGATAGTAATCAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-3         GAGATAGTAATCAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAGTGCTAAAATCATAATAGTACAGCTG
S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V2-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATGATAGTACAGCTG
S13V3-7         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V2-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-7         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
                *********** **** ***************** ******** *** ************  
S13V4-1         AAGGAATCTGTAGAGATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-3         AAGGAATCTGTAGAGATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V4-4         AAGGAGTCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V2-2         AAGGAATTTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-7         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V2-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V3-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V4-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V4-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-7         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
                ***** * ****** ***************** ************************ ** 
S13V4-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-4         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V3-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V2-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-1         ATAGGACCAGGGAGAGCGTTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-4         ATAGAACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-7         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V2-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-7         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-4         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
                ** * ************ ** ********** ****************************
S13V4-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGAAAGGTAGCTGCAAAATTA
S13V4-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGAAAGGTAGCTGCAAAATTA
S13V3-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-3         TATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V2-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-7         TATTGTAACACCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-2         TATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V2-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V4-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-7         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
                ********** ********* ******** ********* ** *****************
S13V4-1         AGAGGACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-3         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-2         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-4         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAGTCAATCATCA
S13V5-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V2-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-5         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-7         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         AGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V2-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-5         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-6         AGAAAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-7         AGAAAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
                ***  *******  ******************** **********
Table 3
Subject Number of Clones S Theta
9 64 68 14.334
4 47 63 14.196
13 26 68 17.642

Scientific Conclusion

Acknowledgments

  • Wiki syntax for Table 2 and Table 3 copied from the Week 5 assignment page.
  • Nucleotide sequences were obtained from PubMed.
  • Data for all subjects was obtained from BEDROCK website.

Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

References

BIOL368 Assignments

Week 1: Instructions, Class Journal and User Page

Week 2: Instructions, Class Journal and Individual Assignment

Week 3: Instructions, Class Journal and Individual Assignment

Week 4: Instructions, Class Journal and Individual Assignment

Week 5: Instructions, Class Journal and Individual Assignment

Week 6: Instructions, Class Journal and Individual Assignment

Week 8: Instructions, Class Journal and Individual Assignment

Week 9: Instructions, Class Journal and Individual Assignment

Week 10: Instructions, Class Journal and Individual Assignment

Week 13: Instructions, Class Journal and Individual Assignment

Week 14: Instructions, Class Journal and Individual Assignment

BIOL388 Assignments

Week 1: Instructions, Class Journal and User Page

Week 2: Instructions, Class Journal and Individual Assignment

Week 3: Instructions, Class Journal and Individual Assignment

Week 4/5: Instructions, Class Journal and Individual Assignment

Week 6: Instructions, Class Journal and Individual Assignment

Week 7: Instructions, Class Journal and Individual Assignment

Week 9: Instructions, Class Journal and Individual Assignment

Week 10: Instructions, Class Journal and Individual Assignment

Week 11: Instructions, Class Journal and Individual Assignment

Week 12: Instructions, Class Journal and Individual Assignment

Week 14/15: Instructions and Individual Assignment

Template for Assignments