Search results

From OpenWetWare
Jump to navigationJump to search
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)
  • Lecture: Mondays 1:00 to 1:50 pm P&A room 5 Labs (choose one): Mondays 2:00 to 4:50 pm P&A room 135 Wednesdays 2:00 to 4:50 P&A room 135 The Fall 2008...
    3 KB (382 words) - 21:47, 24 August 2009
  • campus. Tuesdays practice and review session in Mac Hall room 1162 from 2-3:50 or as noted on schedule, and Thursdays (Presentations) from 3 to 5 pm, Medical...
    2 KB (320 words) - 21:33, 14 February 2012
  • update Week 8 progress update Week 9 progress update Week 10 progress update, 50% complete Final Presentation (incomplete) --old Final Presentation (complete)...
    7 KB (869 words) - 11:28, 3 November 2006
  • Bacterial Chemotaxis on Dynamics of Microbial Competition", Microb. Ecol. 16, 115-131 (1988). 40. Lauffenburger, D.A., R.T. Tranquillo and S.H. Zigmond, "Concentration...
    50 KB (8 words) - 21:01, 13 December 2005
  • Lecture: Mondays 1:00 to 1:50 pm P&A room 5 Labs (choose one): Mondays 2:00 to 4:50 pm P&A room 135 Wednesdays 2:00 to 4:50 P&A room 135 The Fall 2008...
    3 KB (380 words) - 03:20, 23 August 2010
  • Lecture: Mondays 1:00 to 1:50 pm P&A room 184 Labs (choose one): Mondays 2:00 to 4:50 pm P&A room 116 Wednesdays 2:00 to 4:50 P&A room 116 The Fall 2008...
    3 KB (385 words) - 17:45, 24 August 2009
  • high aeration Mtb exposed to 50 μM DETA/NO at high aeration How many microarray chips did they hybridize in the experiment? 131 chips Which samples were paired...
    9 KB (1,107 words) - 07:23, 19 November 2014
  • prerequisites Grading 25% Participation 25% Personal wiki page (weekly assignments) 50% Contribution to group project 2005 2003 and earlier List of abbreviations:...
    2 KB (259 words) - 12:56, 3 May 2007
  • 13 14 . . . . 139 140 . . . . 265 266 . . . . 16 15 . . . . 142 141 . . . . 268 267 . . . . 17 18 19 20 . . 143 144 145 146 . . 269 270 271 272 . . 24...
    6 KB (521 words) - 14:36, 27 July 2006
  • Lecture: Mondays 1:00 to 1:50 pm P&A room 184 Labs (choose one): Mondays 2:00 to 4:50 pm P&A room 116 Wednesdays 2:00 to 4:50 P&A room 116 The Fall 2007...
    2 KB (200 words) - 16:08, 25 August 2008
  • C c5.0.16 and 17: bottom lid latches (16) and "splits" (17) oligo 80la c5.0.16.1 TAATTTCCTGACGAGAAACACTTTTTTTAGAGACGACCATAC oligo 30la c5.0.16.2 GGATT...
    35 KB (134 words) - 20:28, 12 September 2006
  • high aeration Mtb exposed to 50 μM DETA/NO at high aeration How many microarray chips did they hybridize in the experiment? 131 chips Which samples were paired...
    23 KB (3,297 words) - 19:20, 19 November 2014
  • Introduction to Programming using Python for Biologists at the Pasteur Institute [16] Python HOWTOs [17] Regular Expression HOWTO [18] Python Programming Tutorial...
    27 KB (1,648 words) - 03:07, 5 August 2008
  • mechanomolecular signaling in platelets Blood 131: 787-796, 2018 PMID 29203584 with a commentary in Blood 131: 713-714 Inside Blood Commentary 55. Chen W...
    32 KB (3,912 words) - 05:27, 14 February 2025
  • midipreparations: pTol2 L/R 260 nm Absorbance: 0.131 AU 280 nm Absorbance: 0.080 AU A260/A280: 1.6424 [DNA] = (0.131 AU)(0.05 [µg/µL]/AU)(1000 µL/ 5µL) = 1.31...
    49 KB (6,866 words) - 19:15, 1 February 2007
  • AGTAACAA CCCGTCGG TTAACCAA cho 15 : TAGGAACG ATATTCAA CCGTTCTA AATGCAAT cho 16 : GCCTGAGT GATACATT TCGCAAAT AAGTACGG cho 17 : TGTCTGGA CCATAAAT CAAAAATC...
    18 KB (27 words) - 03:55, 23 October 2015
  • Lipofectamine 1.5 ml, 06/14/2007 Sigma-aldrich, dichlorodimethylsilane 100 ml, 06/11/20 4x cryocane alum 6 place , # 15 350 21, 06/08/2007 Rhomsdine, #P1 46102, 06/08/2007...
    38 KB (119 words) - 03:29, 21 September 2008
  • prepare a solution of 20% DMSO in staining buffer. Add 2 mL of staining buffer and 500 μL of 20% STERILE DMSO. Add 500 µL of 20% DMSO to each tube. Mix...
    28 KB (5,407 words) - 16:03, 16 March 2010
  • QR 15'DH : CGGAATCACTGTAGCTCAACATGTTTTATCCTCTTTTGAGGAACAAGTTTTCTTGGAATA QR 16 : AGGTAGAAAGATTCATCAGTTGAGATTGCTGA QR 16DH : AGGTATCCTCTTTTGAGGAACAAGTTTT...
    25 KB (8 words) - 03:47, 25 October 2014
  • pharmacokinetics of methotrexate in rats. Biopharm Drug Dispos. 1995 Apr;16(3):245-50. (pmid=7787136) Kim EJ, Yoon WH, Lee WI, Kim ON, Lee MG. The effect of...
    27 KB (9 words) - 04:30, 24 March 2025
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)