IGEM:Harvard/2006/Container Design 5/Oligos

From OpenWetWare
Jump to: navigation, search






(Pre)Working Stocks

Table of c5.0 Working Stocks

Aptamer Oligos (9/12)

  • Sequences actually ordered (ie. sequences that are long enough that we actually need them, and that we didn't already have in another order) are in italics.
  • Thus, BE CAREFUL when making pre-working stocks - read the notes next to each oligo and make sure ALL of the necessary oligos are included.
  • Excel document used to organize these is here.
c5.0.21 ' (outward-facing barrel oligos @ aptamers +aptamers) '
original, unmodified oligo oligo # sequence notes
oligo 7 c5.0.21.1a ATAAATC GTGTTGT TCCAGTT ttt ggttggtgtggttgg
oligo 7 c5.0.21.1b TGGAACAAGAGTCCGTAAAGC (don't need to reorder - same as c5.0.8.1rb, so use that instead)
oligo 43 c5.0.21.2a GCCGGAA GCAGGTC GACTCTA AGGGGGA ttt ggttggtgtggttgg
oligo 43 c5.0.21.2b TGTGCTGCGGAAAC (don't need to reorder - same as c5.0.8.2rb, so use that instead)
oligo 65 c5.0.21.3 TCATTTT TTTACAA ACAATTC AAATGAA AAATCTA GATAAAA ttt ggttggtgtggttgg
oligo 75 c5.0.21.4 ATCAATA GATAAAA ATTTTTA GAACCCT CATATAT ATTAGCA ttt ggttggtgtggttgg
oligo 78 c5.0.21.5a GGTATTA AATATCC CATCCTA ttt ggttggtgtggttgg
oligo 78 c5.0.21.5b ATTTACGAGCATGTCGAGCCA (don't need to reorder - same as c5.0.8.5rb, so use that instead)


c5.0.22 ' (inward-facing barrel oligos @ aptamers +aptamers) '
original, unmodified oligo oligo # sequence notes
oligo 33 c5.0.22.1a GCCGCCA TTGATAT TCACAAA ttt ggttggtgtggttgg
oligo 33 c5.0.22.1b CAAATAAATCCTCATCTGAAT (don't need to reorder - same as 5.0.9.1rb, so use that instead)
oligo 67 c5.0.22.2a ATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA ttt ggttggtgtggttgg
oligo 67 c5.0.22.2b ACGGGTA (too short - don't need to order)
oligo 89 c5.0.22.3a TGGATAG CGATAAA AACCAAA ttt ggttggtgtggttgg
oligo 89 c5.0.22.3b ATAGCGAGAGGCTTACAACAT (don't need to reorder - same as 5.0.9.3rb, so use that instead)
oligo 95 c5.0.22.4a AAAGAAA AATGAAT TTTCTGT TCACCAG TACAAAC ttt ggttggtgtggttgg
oligo 95 c5.0.22.4b TACAACG (too short - don't need to order)
oligo 104 c5.0.22.5a TCATTTG TTCTGCG ttt ggttggtgtggttgg
oligo 104 c5.0.22.5b AACGAGTGGTCATTTTTGCGGACCAGAC (don't need to reorder - same as 5.0.9.5rb, so use that instead)

Revised Biotinylated c5.0.8 and c5.0.9 Oligos (8/25)


c5.0.8revised (outward-facing) ("a" and "b" denote the splitting of the original, unmodified oligos' sequences)
oligo 7 c5.0.8.1ra ATAAATC GTGTTGT TCCAGTT -biotin
oligo 7 c5.0.8.1rb TGGAACAAGAGTCCGTAAAGC
oligo 43 c5.0.8.2ra GCCGGAA GCAGGTC GACTCTA AGGGGGA -biotin
oligo 43 c5.0.8.2rb TGTGCTGCGGAAAC
oligo 65 c5.0.8.3r TCATTTT TTTACAA ACAATTC AAATGAA AAATCTA GATAAAA-biotin (don't need to order - same as c5.0.8.3)
oligo 75 c5.0.8.4r ATCAATA GATAAAA ATTTTTA GAACCCT CATATAT ATTAGCA-biotin (don't need to order - same as c5.0.8.4)
oligo 78 c5.0.8.5ra GGTATTA AATATCC CATCCTA -biotin
oligo 78 c5.0.8.5rb ATTTACGAGCATGTCGAGCCA
c5.0.9revised (inward-facing) ("a" and "b" denote the splitting of the original, unmodified oligos' sequences)
oligo 33 c5.0.9.1ra GCCGCCA TTGATAT TCACAAA -biotin
oligo 33 c5.0.9.1rb CAAATAAATCCTCATCTGAAT
oligo 67 c5.0.9.2ra ATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA -biotin
oligo 67 c5.0.9.2rb ACGGGTA (don't need to order)
oligo 89 c5.0.9.3ra TGGATAG CGATAAA AACCAAA -biotin
oligo 89 c5.0.9.3rb ATAGCGAGAGGCTTACAACAT
oligo 95 c5.0.9.4ra AAAGAAA AATGAAT TTTCTGT TCACCAG TACAAAC -biotin
oligo 95 c5.0.9.4rb TACAACG (don't need to order)
oligo 104 c5.0.9.5ra TCATTTG TTCTGCG -biotin
oligo 104 c5.0.9.5rb AACGAGTGGTCATTTTTGCGGACCAGAC

Attachment-Ligand Oligo Order (8/8)

c5.0.4o: barrel oligos @ outside aptamers +ligand-binding-site (includes "splits," divided into "a" and "b")
oligo 7 c5.0.4.1oa ATAAATCGTGTTGTTCCAGTTTTTTTTTTCCGCGGGCGCGCCCC
oligo 7 c5.0.4.1ob TGGAACAAGAGTCCGTAAAGC
oligo 43 c5.0.4.2oa GCCGGAAGCAGGTCGACTCTAAGGGGGATTTTTTTTCCGCGGGCGCGCCCC
oligo 43 c5.0.4.2ob TGTGCTGCGGAAAC
oligo 65 c5.0.4.3oa TCATTTTTTTACAAACAATTCAAATGAA
oligo 65 c5.0.4.3ob AAATCTAGATAAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 75 c5.0.4.4oa ATCAATAGATAAAAATTTTTA
oligo 75 c5.0.4.4ob GAACCCTCATATATATTAGCATTTTTTTTCCGCGGGCGCGCCCC
oligo 78 c5.0.4.5oa GGTATTAAATATCCCATCCTAATTTTTTTTTTTCCGCGGGCGCGCCCC
oligo 78 c5.0.4.5ob ACGAGCATGTCGAGCCA
c5.0.5o: barrel oligos @ inside aptamers +ligand-binding-sites (includes "splits," divided into "a" and "b"
oligo 33 c5.0.5.1oa GCCGCCATTGATATTCACAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 33 c5.0.5.1ob CAAATAAATCCTCATCTGAAT
oligo 67 c5.0.5.2oa ATTTACATTTTGCGGGATCGTGAAGTTT
oligo 67 c5.0.5.2ob CCATTAATTTTTTTTCCGCGGGCGCGCCCC
oligo 89 c5.0.5.3oa TGGATAGCGATAAAAACCAAATTTTTTTTCCGCGGGCGCGCCCC
oligo 89 c5.0.5.3ob ATAGCGAGAGGCTTACAACAT
oligo 95 c5.0.5.4oa AAAGAAAAATGAATTTTCTGTTCACCAG
oligo 95 c5.0.5.4ob TACAAACTTTTTTTTCCGCGGGCGCGCCCC
oligo 104 c5.0.5.5oa TCATTTGTTCTGCGTTTTTTTTCCGCGGGCGCGCCCC
oligo 104 c5.0.5.5ob AACGAGTGGTCATTTTTGCGGACCAGAC

Latch Order (8/8)

c5.0.10 and 11: barrel latches (10) and the left-over "splits" of the latches (11)
oligo 30la c5.0.10.1 GGATTAGCCCTCAGTTTTTTTTTTCCGGTGCAGAAGTTT
oligo 179la c5.0.10.2 GTCCACGGAGAGAGTTTTTTTTTTTTTGGCACTCCTACAATT
oligo 139la c5.0.10.3 TTTGAGTACCTACCATATCAATTTTGACGATAGGGAAACA
oligo 86lb c5.0.10.4 TTAATATGGATTCTTTTTTTTTTTTTGGATCGGTACATTGT
oligo 84la c5.0.10.5 GCATCGGCCTACATTTTGACGACCGCCA
oligo 164la c5.0.10.6 GTTTGAAACATGTATTTTTTTTTTTAAGAGTGATGATAGT
oligo 30lb c5.0.11.1 AACCGCCCCCAATAGGAACCCACGTTAG
oligo 86la c5.0.11.2 GAGAAAGCCCCAAAAACAGGAGTAAACG
oligo 84lb c5.0.11.3 GCCATTGCAACAGG
c5.0.12: barrel latch zippers (latch design 2)
oligo 30laz c5.0.12.1 GTATGGTCGCACCGGTGAGTACCGCTA
oligo 179laz c5.0.12.2 GTTGGTCTGAGTGCCGCACGGCAATAA
oligo 139la c5.0.12.3 TGATCTTCTATCGTCGTTGTGAGCGAT
oligo 86lbz c5.0.12.4 GTATTCGACCGATCCGGACTTTCTAGG
oligo 84laz c5.0.12.5 CGGGGACGCTAACGTGTTGCAGTTTTA
oligo 164laz c5.0.12.6 ATGCTGGCCACTCTTCATGGGTGCTGA
c5.0.13 and 14: top lid latches (13) and "splits" (14)
oligo 64la c5.0.13.1 GCCGATTTATAACGTGCTTTCTTTAGGCAACTCGAATAC
oligo 49la c5.0.13.2 GTCTATATCACCCATTTTTTTTAAACATCCGTCCCCG
oligo 8la c5.0.13.3 CATTTGAGATTCGCCTGATTGTTTTTTTTTTTTTCTCTTGCCAGCAT
oligo 49lb c5.0.14.1 AATCAATGGCAAGTGTAGCGCGCCGCG
oligo 8lb c5.0.14.2 CTTTGAATACCAAGAAAGAAA
c5.0.15: top lid zippers (latch design 2)
oligo 64laz c5.0.15.1 ACAATGTAGTTGCCTGGTTAAGGGTAC
oligo 49laz c5.0.15.2 ACCTGATGGATGTTTATCAACGGGTGT
oligo 8laz c5.0.15.3 ACTATCATAAGAGAACGCCGTCTCAGC
c5.0.16 and 17: bottom lid latches (16) and "splits" (17)
oligo 80la c5.0.16.1 TAATTTCCTGACGAGAAACACTTTTTTTAGAGACGACCATAC
oligo 30la c5.0.16.2 GGATTAGCCCTCAGTTTTTTTTTTGTAGTAGAGACCAAC
oligo 52lb c5.0.16.3 CCTTCATTATTCATTTTTTTTTTTTTCCTACGAGAAGATCA
oligo 30lb c5.0.17.1 AACCGCCCCCAATAGGAACCCACGTTAG
oligo 52la c5.0.17.2 CATCGCCTGGCTGA
oligo 52lc c5.0.17.3 TACCCAAGGCTCAT
c5.0.18: bottom lid zippers (latch design 2)
oligo 80laz c5.0.18.1 AAACTTCTGTCTCTATCTCTTCAGTCG
oligo 30laz c5.0.18.2 AATTGTAGCTACTACCGAAGGCTATTC
oligo 52lbz c5.0.18.3 TGTTTCCCTCGTAGGTCAGTGCTTGTG
c5.0.19: barrel latch displacers
oligo 30lad c5.0.19.1 TAGCGGTACTCACCGGTGCGACCATAC
oligo 179lad c5.0.19.2 TTATTGCCGTGCGGCACTCAGACCAAC
oligo 139lad c5.0.19.3 ATCGCTCACAACGACGATAGAAGATCA
oligo 86lbd c5.0.19.4 CCTAGAAAGTCCGGATCGGTCGAATAC
oligo 84lad c5.0.19.5 TAAAACTGCAACACGTTAGCGTCCCCG
oligo 164lad c5.0.19.6 TCAGCACCCATGAAGAGTGGCCAGCAT
c5.0.20: top lid displacers
oligo 64lad c5.0.20.1 GTACCCTTAACCAGGCAACTACATTGT
oligo 49lad c5.0.20.2 ACACCCGTTGATAAACATCCATCAGGT
oligo 8lad c5.0.20.3 GCTGAGACGGCGTTCTCTTATGATAGT
c5.0.21: bottom lid displacers
oligo 80lad c5.0.21.1 CGACTGAAGAGATAGAGACAGAAGTTT
oligo 30lad c5.0.22.2 TTATTGCCGTGCGGCACTCAGACCAAC
oligo 52lbd c5.0.23.3 CACAAGCACTGACCTACGAGGGAAACA

Oligo order (7/24)

Just core oligos. No aptamers or latches. Biotinylated oligos were ordered seperately, also 7/24.

c5.0.1: core barrel oligos
oligo 0 c5.0.1.1 TAAAGTATAGCATT
oligo 1 c5.0.1.2 AAGTCAGAGGGTAATTGAGCGAAACCGAGGAAACGCTGGCAT
oligo 2 c5.0.1.3 GATTAAGTCTACTAATAGTAGCGGTGTCTGGAAGTATGCTGT
oligo 3 c5.0.1.4 AGCTCAAAAAGACTTCAAATAAGCAAAGCGGATTGGTAATAG
oligo 4 c5.0.1.5 TAAAATGAGGCAAGTCCGCTACGTATAAGGCGCTCACAATTC
oligo 5 c5.0.1.6 CACACAAGCCAGCTGCATTAAGGTAGAAAGATTCATACCAGT
oligo 6 c5.0.1.7 CAGGACGTTGGGAAGAAAAATACAAAGCTGCTCATATCCCTT
oligo 8 c5.0.1.8 ACTAAATGTGGCGAGAAAGGAAGGCCGATTAAAGGGAGGCCA
oligo 9 c5.0.1.9 CCGAGTATCCAGAACAATATTCTCAATCGTCTGAAACAGACA
oligo 10 c5.0.1.10 ATATTTTAAAAATACCGAACGAACCACCAGCAGAAAAGCATC
oligo 11 c5.0.1.11 ACCTTGCCTTGATACCGATAGTTTTTCACGTTGAAAATCTCC
oligo 12 c5.0.1.12 AAAAAAATCCAGACGTTAGTACCACCAGAAGGAGCCTGATTG
oligo 13 c5.0.1.13 TTTGGATTATACTTCTGAATACGTCAGATGAATATCCGCCAC
oligo 14 c5.0.1.14 CCTCAGACCAGGCGGATAAGTTGCCTATTTCGGAATACATGG
oligo 15 c5.0.1.15 CTTTTGATCAGACGATTGGCCCCCTCAGAACCGCCTCGGTCA
oligo 16 c5.0.1.16 TAGCCCCGGCTTATCCGGTATCCAGTTACAAAATAAACAGCC
oligo 17 c5.0.1.17 ATATTATGCAGCCTTTACAGAACCGTCACCGACTTTTTTGTC
oligo 18 c5.0.1.18 ACAATCAATAGAAAATTCATAAGTATGTTAGCAAACAGATAG
oligo 19 c5.0.1.19 CCGAACAGCAATAAAGCCTCAGAGCATAAAGCTAATATTTCA
oligo 20 c5.0.1.20 ACGCAAGTGATATTCAACCGTTAGCATGTCAATCATAAATCA
oligo 21 c5.0.1.21 GCTCATTCAGCTTTCATCAACTCTGCCAGTTTGAGACCGCTT
oligo 22 c5.0.1.22 CTGGTGCCAAGGCGATTAAGTTGGGTAACGCCAGGCGACGGC
oligo 23 c5.0.1.23 CAGTGCCATTCATTGAATCCCATAGTAAGAGCAACACTATCA
oligo 24 c5.0.1.24 TAACCCTGGAATACCACATTCCCCGCTTTCCAGTCAGCTGAT
oligo 25 c5.0.1.25 TGCCCTTCACCGCCTGGCCCTCTGGTTTGCCCCAGTAGTAAA
oligo 26 c5.0.1.26 TTGGGCTCAGATGAACGGTGTCAATCATAAGGGAAAAAAGAA
oligo 27 c5.0.1.27 TACACTATAATGCCACTACGACTGAGGCTTGCAGGACAACAA
oligo 28 c5.0.1.28 CCATCGCTGAGAGCCAGCAGCGACAACTCGTATTAAATCCTT
oligo 29 c5.0.1.29 TACTTTTGCGGGAGAAGCCTTATCGGTTGTACCAATACCGAA
oligo 31 c5.0.1.30 AATCCAACCCAATAGCAAGCAGCAAGCCGTTTTTACGCCTGT
oligo 32 c5.0.1.31 TTATCAACAATAGATAAGTCCAGTAATTCTGTCCACCTCAGA
oligo 34 c5.0.1.32 TTACCGTTACTAGAAAAAGCCATAGGTCTGTCCAATCGCAAG
oligo 35 c5.0.1.33 ACAAAGAGCGATAGCTTAGATGGTTTTGCTCAGTAACCGCCA
oligo 36 c5.0.1.34 CCCTCAGAACACTGAGTTTCGATGGGATTTTGCTATTGCGAA
oligo 37 c5.0.1.35 TAATAATTTGCGCCGACAATGGAGTTAAAGGCCGCTTGGCAG
oligo 38 c5.0.1.36 ATTCACCACTCAAACTATCGGCCTTGCTGGTAATAAAAGAGT
oligo 39 c5.0.1.37 CTGTCCAGACCCCCAGCGATTTACTTAGCCGGAACGAGGCGC
oligo 40 c5.0.1.38 AGACGGTACAGACCAGGCGCAAAGGAGCGGGCGCTAAATCAA
oligo 41 c5.0.1.39 GTTTTTTGGGGTCGAGGTGCCACTATTAAAGAACGGTTTGAT
oligo 42 c5.0.1.40 GGTGGTTGTGAGACGGGCAACGGGAAACCTGTCGTCATACGA
oligo 44 c5.0.1.41 CAGGCAAAGCGCCATTCGCCAGTGTAGATGGGCGCCTATTAT
oligo 45 c5.0.1.42 AGTCAGATCGCGTTTTAATTCGAGCTTCAAAGCGAATGGCTT
oligo 46 c5.0.1.43 AGAGCTTCATTAAATTTTTGTTATGTACCCCGGTTGATAATC
oligo 47 c5.0.1.44 AGAAAAGGCCGGAGACAGTCAAAGGTGGCATCAATACTCCTT
oligo 48 c5.0.1.45 ATTACGCTGGTTTACCAGCGCGGAAATTATTCATTATCGATA
oligo 49 c5.0.1.46 GCAGCACTTTCATCGGCATTTACCCTCAGAGCCACGAGAATA
oligo 50 c5.0.1.47 TAAAGTATTGAGAATCGCCATATTTAACAACGCCAATACCGA
oligo 51 c5.0.1.48 CCGTGTGACTGGTAATAAGTTAGTGCCCGTATAAACAGTTAA
oligo 52 c5.0.1.49 TGCCCCCGCCGTCGAGAGGGTATTTTCCCTTAGAAGGAAACA
oligo 53 c5.0.1.50 GTACATAAATCAATATATGTGTTTGAATACCAAGTTTTTACA
oligo 54 c5.0.1.51 TCGGGAGTCATCAATATAATCGGAATTATCATCATGTTGAAA
oligo 55 c5.0.1.52 GGAATAACAAACCCTCAATCAAAAACATCGCCATTTGAATGG
oligo 56 c5.0.1.53 CTATTAGTCTTTAA
oligo 57 c5.0.1.54 TATTTTTGATAATCGTAAAACTCTAGCTGATAAATATAACCT
oligo 58 c5.0.1.55 GTTTAGCACATAAAGGTGGCAACGGAATAAGTTTAGAGCCAT
oligo 59 c5.0.1.56 TTGGGAAACCATTACCATTAGCCATCTTTTCATAAACCGGAA
oligo 61 c5.0.1.57 ACGCTCAACCGGAATCATAATTCCAGTAAGCGTCACCTATTA
oligo 62 c5.0.1.58 TTCTGAAACATGAAAGTATTAATTAGGATTAGCGGTAAGACG
oligo 63 c5.0.1.59 CTGAGAATTAATTACATTTAACAATTTCATTTGAAATTTCAA
oligo 64 c5.0.1.60 TTACCTGATTTTCAGGTTTAAATGGAAGGGTTAGAAACATTA
oligo 66 c5.0.1.61 CAGAGGTCTGACCTGAAAGCGTAAGAATACGTGGCATGGATT
oligo 68 c5.0.1.62 AAATACGAAACACTCATCTTTTCACGCAAATTAACGTTAGAA
oligo 69 c5.0.1.63 TCAGAGCGGGAGCTAAACAGGAGGGAAGAAAGCGATAGGCTG
oligo 70 c5.0.1.64 GCTGACCTTGCCCTGACGAGAGAACTGGCTCATTATCAGTTG
oligo 71 c5.0.1.65 AGATTTACGTTTACCAGACGACGTCCAATACTGCGGGTCTTT
oligo 72 c5.0.1.66 ACCCTGAATCGTAACCGTGCAATTAAATGTGAGCGAGTAACA
oligo 73 c5.0.1.67 ACCCGTCTTTGTTAAAATTCGAATTGCTGAATATATTCATTC
oligo 74 c5.0.1.68 CATATAACAGTTGATTCCCAAGGGCGCGAGCTGAAAATCACC
oligo 76 c5.0.1.69 AAATTAAAAGTTACCAGAAGGCTAATATCAGAGAGAACAGGG
oligo 77 c5.0.1.70 AAGCGCACAGAGCCTAATTTGTCTAAGAACGCGAGAAGAACG
oligo 79 c5.0.1.71 GTAATAACACCCTCAGAGCCGGCCAGCATTGACAGGAGGTTG
oligo 80 c5.0.1.72 AGGCAGGTGATACAGGAGTGTATAAATAAGGCGTTTTTCAAA
oligo 81 c5.0.1.73 TATATTTTAGTTAATTTCATCGTCGCTATTAATTATGATATA
oligo 82 c5.0.1.74 AGTATAGAGGAGGTTTAGTACCATTCCACAGACAGAGTTTTG
oligo 83 c5.0.1.75 TCGTCTTAGGCTCCAAAAGGATTGCTTTCGAGGTGAAAGACA
oligo 85 c5.0.1.76 ATCATACAGGCAAGGCAAAGATTTAAATGCAATGCAAAGGGT
oligo 87 c5.0.1.77 CCGTGGGGATAGGTCACGTTGTTCAGGCTGCGCAACCTCTTC
oligo 88 c5.0.1.78 GCTATTACGCCAGCTGGCGAAGACCTTTGATAGCGTTTAGAC
oligo 90 c5.0.1.79 TATTACATGAATCGGCCAACGGGCGCCAGGGTGGTTTTTCTT
oligo 91 c5.0.1.80 TTCACCACCGAAATCGGCAAATCAGTGAATAAGGCTTCATCA
oligo 92 c5.0.1.81 AGAGTAAGACCTGCTCCATGTATACCAAGCGCGAAGACTTTT
oligo 93 c5.0.1.82 TCATGAGCACCCTCAGCAGCGAATTTCTTAAACAGTGAACCT
oligo 94 c5.0.1.82 CAAATATTACATTTGAGGATTTAGAAGTATTAGACGCGGAAC
oligo 96 c5.0.1.83 CCTGTAGCGCCACCCTCAGAAACAGTAACAGTACCTACAAAA
oligo 97 c5.0.1.84 TCGCGCAGAGGCGAATTATTCTTACCTTTTTTAATTCCTTGA
oligo 98 c5.0.1.85 AAACATAACGCGAGAAAACTTAAATAAGAATAAACACAGTAG
oligo 99 c5.0.1.86 GGCTTAACCGACAAAAGGTAATGAACAAGAAAAATAACCAAG
oligo 100 c5.0.1.87 TACCGCACTCATCGAGAACAAAATCAGATATAGAACTTATTA
oligo 101 c5.0.1.88 GCGTTTGCAAGGCCGGAAACGTCACCAATGAAACCAAAGGTG
oligo 102 c5.0.1.89 AATTATCGAGAATAACATAAAATAACCCACAAGAATTGAGTT
oligo 103 c5.0.1.90 AAGCCCATTAAGAAAAGTAAGCGTAGAAAATACATTATATTT
oligo 105 c5.0.1.91 CGGAAGCTAAATCAAAAATCAGAATCGTCATAAATAAGCTTG
oligo 106 c5.0.1.92 CATGCCTGCATAAAGTGTAAAGCCTGGGGTGCCTACGTTGCG
oligo 107 c5.0.1.93 CTCACTGAACTAATGCAGATACATTGTGAATTACCTTATGCG
oligo 109 c5.0.1.94 CAACGTCAAAGGGCGAAAAACGTGAACCATCACCCAGGGCGC
oligo 110 c5.0.1.95 TGGCAAGCCACACCCGCCGTCCGTTGTAGCAATACGCCTGAG
oligo 111 c5.0.1.96 TAGAAGAAGTCACACGACCAGGAGATAGAACCCTTGAGGCGG
oligo 112 c5.0.1.97 TCAGTATTAACACC
oligo 113 c5.0.1.98 ATGGTCATAATGCC
oligo 114 c5.0.1.99 CGCGTCTGGCCTTCCTGTAGCTTTTAACCAATAGGTCCTTTT
oligo 115 c5.0.1.100 GATAAGAAGATTTAGTTTGACCATTAGA
oligo 116 c5.0.1.101 AAGCCCGCATGTTT
oligo 117 c5.0.1.102 TAATTGCAACGCCA
oligo 118 c5.0.1.103 CACTCCAGCCAGCTTTCCGGCGGGACGACGACAGTAACGAGA
oligo 119 c5.0.1.104 ATGACCAAAACTCCAACAGGTCAGGATT
oligo 120 c5.0.1.105 AGAGGGGCATCAAA
oligo 121 c5.0.1.106 TTCAGAAATCGGCC
oligo 122 c5.0.1.107 ACGAGGCCCTCAAA
oligo 123 c5.0.1.108 TAACGGATTGCAAA
oligo 124 c5.0.1.109 CTTTAATCATAACG
oligo 125 c5.0.1.110 CAACGTACTACGTT
oligo 126 c5.0.1.111 AAGAGGATGAGATG
oligo 127 c5.0.1.112 TGACGGGGGATATT
oligo 128 c5.0.1.113 ATAAATTGTGTCGAAATCCGCTCTTGACAAGAACCGAAAGCC
oligo 129 c5.0.1.114 GGCGAACCGGAACCCTAAAGGGAGCCCC
oligo 130 c5.0.1.115 AAGAGGCCCGAACT
oligo 131 c5.0.1.116 AGAAGTGAGATTTG
oligo 132 c5.0.1.117 ACAGAGGCTTTGAGGACTAAAACAAAGTACAACGGTTTTTAT
oligo 133 c5.0.1.118 AATCAGTGATTTTAGACAGGAACGGTAC
oligo 134 c5.0.1.119 TCGGTCGAGGCACC
oligo 135 c5.0.1.120 GGAAATAAACGAGG
oligo 136 c5.0.1.121 TATCAGCGCCTTTA
oligo 137 c5.0.1.122 GCCACGCCCACGCA
oligo 138 c5.0.1.123 AGAAAGGAACAACTAAAGGAAAACAACTTTCAACATTAAAAG
oligo 140 c5.0.1.124 GATCTAACCCTCAT
oligo 141 c5.0.1.125 ATTAATTGTTTCAG
oligo 142 c5.0.1.126 CAATAGGAACCCATGTACCGTAGCCACCACCCTCAAAGAAAT
oligo 143 c5.0.1.127 TGCGTAGAGCAAAAGAAGATGATGAAAC
oligo 144 c5.0.1.128 CGTACTCCCCGGAA
oligo 145 c5.0.1.129 AGAAATATTTTCAG
oligo 146 c5.0.1.130 GAGAAGGAGAGGCT
oligo 147 c5.0.1.131 GAGTAACTTAACGG
oligo 148 c5.0.1.132 CGCAGTCTTAAAGC
oligo 149 c5.0.1.133 AGCCGCCCCACCAG
oligo 150 c5.0.1.134 AGCCACCTCAAAAT
oligo 151 c5.0.1.135 TAGCGTCCTCCCGA
oligo 152 c5.0.1.136 GCTGTCTTTCCTTATCATTCCGCGTTTTAGCGAACAGACTGT
oligo 153 c5.0.1.137 AGCGCGTCGTAATCAGTAGCGACAGAAT
oligo 154 c5.0.1.138 CAGTAGCTTAGAGC
oligo 155 c5.0.1.139 GGAGGGATAACTGA
oligo 156 c5.0.1.140 TTTGAAGCCTTAGCGTCTTTCTTAGACGGGAGAATAGGTAAA
oligo 157 c5.0.1.141 TATTGACCAAAGACAAAAGGGCGACATT
oligo 158 c5.0.1.142 AGACACCACATATA
oligo 159 c5.0.1.143 AAAAGAACAATAAT
oligo 160 c5.0.1.144 GCTATCTAAACATT
oligo 161 c5.0.1.145 TTAACGTAAACAAT
oligo 162 c5.0.1.146 TACCGCGATAAGAA
oligo 163 c5.0.1.147 CAGAACGTTTTCAT
oligo 164 c5.0.1.148 GCATTTTAGAAACC
oligo 165 c5.0.1.149 TATACAAACAACAT
oligo 166 c5.0.1.150 GTTTGAAACATGTA
oligo 167 c5.0.1.151 CAAAATCTGTTTAG
oligo 168 c5.0.1.152 GTAAATCTTCTGAC
oligo 169 c5.0.1.153 AACAAAAGAGTCAA
oligo 170 c5.0.1.154 TGATTGCAGTGAAT
oligo 171 c5.0.1.155 TGGCAATAAACAAT
oligo 172 c5.0.1.156 ATCAACAATTCCTG
oligo 173 c5.0.1.157 TAGCCCTATATCTG
oligo 174 c5.0.1.158 GCCAACATAATAAA
oligo 175 c5.0.1.159 ATCACTTTTCTTTG
oligo 176 c5.0.1.160 GTAACCATGTAGCG
oligo 177 c5.0.1.161 CCACTACCGTCTAT
oligo 178 c5.0.1.162 GGGTTGAAAAAGAA
oligo 179 c5.0.1.163 GTCCACGGAGAGAG
oligo 180 c5.0.1.164 CGTATTGCGCGGGG
oligo 181 c5.0.1.165 TTAATTGATGAGTG
oligo 182 c5.0.1.166 TAGTACCGCGACCG
oligo 183 c5.0.1.167 TGTAAAAGTTTTCC
oligo 184 c5.0.1.168 GTGCGGGCTGTTGG
oligo 185 c5.0.1.169 GTAATGGAACAAAC
oligo 186 c5.0.1.170 TTAAATTAGATTGT
oligo 187 c5.0.1.171 AGATTCACTGAGTA
c5.0.2: top lid oligos
oligo 0 c5.0.2.1 CCCTGCCAGGGATC
oligo 1 c5.0.2.2 GCCGCCACCAGAACCACCACCCGGAAGTTGGAAGCATCTGTA
oligo 2 c5.0.2.3 AGCAACTCCCTGGAGTGACTCCAGTGCCAAGCTTTCGCCAGG
oligo 3 c5.0.2.4 GTTTTCCTTCCGGCACCGCTTCGACAGTATCGGCCCTGTAGC
oligo 4 c5.0.2.5 CAGCTTTCAATAGGAACGCCAGTAAAACTAGCATGGAGAGTC
oligo 5 c5.0.2.6 TGGAGCAAGTAATGTGTAGGTAAATTTTTAGAACCCATTAAC
oligo 6 c5.0.2.7 ATCCAATCGAGCTGAAAAGGTGTTTTAAATATGCATTAGAGC
oligo 7 c5.0.2.8 TTAATTGCAAAAAGATTAAGAGGAAGCCCGAAAGACAAAAAT
oligo 8 c5.0.2.9 CAGGTCTCCAGAGGGGGTAATAGTAAAATGTTTAGAAGAGCA
oligo 9 c5.0.2.10 ACACTATTCTGGAAGTTTCATCTGTTTAGCTATATTTTCATT
oligo 10 c5.0.2.11 TGGGGCGAAATCATACAGGCACGATTTTAAGAACTATCAACG
oligo 11 c5.0.2.12 TAACAAAGCTGCTCATTCAGTGAACGGTGTACAGAGTGAGAA
oligo 12 c5.0.2.13 AGGCCGGATCTACAAAGGCTATCAGGTCATTGCCTTCAATCA
oligo 13 c5.0.2.14 TATGTACCTCATCTTTGACCCCTACAGAGGCTTTGAGGACTA
oligo 14 c5.0.2.15 AAGACTTGCTTGCAGGGAGTTGTGAGCGAGTAACACCGTGCA
oligo 15 c5.0.2.16 TCTGCCAGTTTGAGGGGACGACTGGTGCCGGAAACAATAATA
oligo 16 c5.0.2.17 ATTTTTTACGATCTAAAGTTTTGTCGTCTTTCCAGATGTACC
oligo 17 c5.0.2.18 GTAACACGGGTGGATGTTCTTAACCCCGCTTCTAATCTATTT
oligo 18 c5.0.2.19 ACGCTCGCGTCGGTGGGCACGTGCTCAGTACCAGGTTGAGTA
oligo 19 c5.0.2.20 ACAGTGCCCGTATAAACAGTTATTTACCGTTCCAGCATTGAC
oligo 20 c5.0.2.21 AGGAGGTTGAGGCAGGTCAGAAACAGGGCTTAAGCGAATCGG
oligo 21 c5.0.2.22 CTGACGCTGTCCCGCCAAAATCTAAGTGGTTGTGATGGCGAA
oligo 22 c5.0.2.23 AGGGGGATTCGCCATTCAGGCTGGGCGCATCGTAAACCCGTC
oligo 23 c5.0.2.24 GGATTCTAAATTCGCATTAAAAGAAAAGCCCCAAAGCTATTT
oligo 24 c5.0.2.25 TTGAGAGAGACAGTCAAATCAAATACTTTTGCGGGCAAAATT
oligo 25 c5.0.2.26 AAGCAATAAATGGTCAATAACTCCATATAACAGTTTTTAATT
oligo 26 c5.0.2.27 GCTCCTTTTTTAATTCGAGCTTCAAAGCGAACCAGCAAATGC
oligo 27 c5.0.2.28 TTTAAACAATACTGCGGAATCGTCATAA
oligo 28 c5.0.2.29 TCCTGGTTGGTGTAATGAGTACGATTGGCCTTGATAAGCCAG
oligo 29 c5.0.2.30 AATGGAAAGCGCAGTCTCTGAAATGCCCCCTGCCTAAGAGAA
oligo 30 c5.0.2.31 GGATTAGCCCTCAGAACCGCCCCCAATAGGAACCCACGTTAG
oligo 31 c5.0.2.32 TAAATGAATAGAAAGGAACAACTTAAACAGCTTGAATTCGGT
oligo 32 c5.0.2.33 CGCTGAGTTTCATGAGGAAGTGAAAGAGGCAAAAGGCTCCAT
oligo 33 c5.0.2.34 GTTACTTGAAAGAGGACAGATGAATAAGGCTTGCCAACTTTA
oligo 34 c5.0.2.35 ATCATTGAAAGATTCATCAGTTTACGAGGCATAGTACTGGAT
oligo 35 c5.0.2.36 AGCGTCCAGTTCAGAAAACGAGAATGACCATAAATCTTCAAA
oligo 36 c5.0.2.37 TATCGCGTTGATAAGAGGTCATTTTTGCGGATGGCACTAAAG
oligo 37 c5.0.2.38 TACGGTGCATAACCCTCGTTTACTAACGGAACAACATTATTA
oligo 38 c5.0.2.39 CAGGTAGTGAATTACCTTATGAGGCAAAGAATTAGAGAAGCC
oligo 39 c5.0.2.40 TTTATTTCAACGCAAGGATAAAAAGATTCAAAAGGCCAGGCG
oligo 40 c5.0.2.41 CATAGGCTGATAAATTGTGTCGAAATCCGCGACCTAATACAC
oligo 41 c5.0.2.42 TAAAACACCCGGTTGATAATCTTTTTGTTAAATCAGCTCATT
oligo 42 c5.0.2.43 TTTTAACCATCAACATTAAATAAAGGCCGCTTTTGTTTATCA
oligo 43 c5.0.2.44 GCTTGCTTTCGAGGTGAATTTCTAAAGGAATTGCGCAGGCAA
oligo 44 c5.0.2.45 AGCGCCATGTGCTGCAAGGCGATTAAGTTGGGTAACTCAGGA
oligo 45 c5.0.2.46 GAAGCCATGAGTTTCGTCACCACCGTACTCAGGAGGTTTAGT
oligo 46 c5.0.2.47 ACCGCCAGATTAGCGGGGTTTAATATAGGGGCCTTTACGTGG
oligo 47 c5.0.2.48 TGCTTGTTACCTCGATAAAGAAGAGCCGCCGCCAGTAAGCGT
oligo 48 c5.0.2.49 CATACATGGCTTTTGATGATAACGGGGTCAGTGCCCGGATAA
oligo 49 c5.0.2.50 GTGCCGTGGAATAGGTGTATCAGTACAAACTACAATCATAGT
oligo 50 c5.0.2.51 TAGCGTACACGTTGAAAATCTTTTAATTGTATCGGCGGGATC
oligo 51 c5.0.2.52 GTCACCCGAGGGTAGCAACGGCCAGCGATTATACCTTTGTAT
oligo 52 c5.0.2.53 CATCGCCTGGCTGACCTTCATTATTCATTACCCAAGGCTCAT
oligo 53 c5.0.2.54 TATACCACGTTAATAAAACGAACCAGACGACGATACAAAAGA
oligo 54 c5.0.2.55 AGTTTTGTTACCCTGACTATTATAGTCA
oligo 55 c5.0.2.56 GAATTGTCAACCTTATGACAAATTTCACATAAATCGGCTGAG
oligo 56 c5.0.2.57 ACTCCTCATTTCGGAACCTATTATTCTG
oligo 57 c5.0.2.58 ATTAAGAATTTCTC
oligo 58 c5.0.2.59 CGACGGCTATGATA
oligo 59 c5.0.2.60 CCTCTTCGCTATTACGCCAGCATTCATGCGCACGATCAGGGA
oligo 60 c5.0.2.61 TAGCAAGACCCTCAGAACCGCCACCCTC
oligo 61 c5.0.2.62 CTCATTTCTTAAGT
oligo 62 c5.0.2.63 GCCAGCTCAGTCAC
oligo 63 c5.0.2.64 GATAGGTCACGTTGGTGTAGATGCGCAACTGTTGGTCAGCGG
oligo 64 c5.0.2.65 AGTGAGAATTTTCTGTATGGGATTTTGC
oligo 65 c5.0.2.66 AACAGTTGAAGGGC
oligo 66 c5.0.2.67 GGCCTTCTCAGGAA
oligo 67 c5.0.2.68 GTAAACGTTAATATTTTGTTACCGTGGGAACAAACCGCATAA
oligo 68 c5.0.2.69 CCGATATTACCGATAGTTGCGCCGACAA
oligo 69 c5.0.2.70 TCGCCCAGGCGGAT
oligo 70 c5.0.2.71 GGTAATCTCAAAAA
oligo 71 c5.0.2.72 AAATTAATGCCGGAGAGGGTAAACAGGAAGATTGTCACCAAC
oligo 72 c5.0.2.73 CTAAAACTTCCATTAAACGGGTAAAATA
oligo 73 c5.0.2.74 ACGAAGGATAAGCA
oligo 74 c5.0.2.75 ATGCCTGAACAAGA
oligo 75 c5.0.2.76 CCAAAAACATTATGACCCTGTCCATCAATATGATAAACTGAC
oligo 76 c5.0.2.77 CAACTTTAGCCGGAACGAGGCGCAGACG
oligo 77 c5.0.2.78 GGAACCGTTCAACC
oligo 78 c5.0.2.79 GTAGTAGCTCATAT
oligo 79 c5.0.2.80 TGACCATTAGATACATTTCGCAAAGCCTCAGAGCAGATGGTT
oligo 80 c5.0.2.81 TAATTTCCTGACGAGAAACACCAGAACG
oligo 81 c5.0.2.82 GGCTTGATAAAGCT
oligo 82 c5.0.2.83 TCAACATGGCATCA
oligo 83 c5.0.2.84 AGGTCAGGATTAGAGAGTACCGATTCCCAATTCTGAACGCCA
oligo 84 c5.0.2.85 AAAGGAATGAGATTTAGGAATACCACAT
oligo 85 c5.0.2.86 GATACATCGAACGA
oligo 86 c5.0.2.87 ATTGCATCTGAATA
oligo 87 c5.0.2.88 TCCCCCTACCGGAA
oligo 88 c5.0.2.89 GCTTTTGAAAACCA
oligo 89 c5.0.2.90 AAATCTAGTCAGGA
oligo 90 c5.0.2.91 AACCGGACAAGAGT
oligo 91 c5.0.2.92 ACGGAGAAAGCGCG
oligo 92 c5.0.2.93 TCGGAACTCAGCAG
oligo 93 c5.0.2.94 AGGAGCCCCAAAAA
oligo 94 c5.0.2.95 ACAGCCCCGCCTGT
oligo 95 c5.0.2.96 ATAGCCCCGAGAGG
oligo 96 c5.0.2.97 AGTTTTACAGGAGT
oligo 97 c5.0.2.98 CTCATTAATTCACA
c5.0.3: bottom lid oligos
oligo 0 c5.0.3.1 CATTAAAGTAGCGC
oligo 1 c5.0.3.2 CGTTGCGCTCACTGCCCGCTTTTTAGCGTCAGACTGGTGAAT
oligo 2 c5.0.3.3 TATCACCAGGGAGGGAAGGTAATGTTAGCAAACGTCCAAAAG
oligo 3 c5.0.3.4 AACTGGCACCCACAAGAATTGCAAAGTCAGAGGGTGTTACAA
oligo 4 c5.0.3.5 AATAAACACCAACGCTAACGACCAATAGCAAGCAACAAGCCG
oligo 5 c5.0.3.6 TTTTTATGCCTGTTTATCAACACGACGACAATAAATTCTTAC
oligo 6 c5.0.3.7 CAGTATAACTAGAAAAAGCCTGATGCAAATCCAATCTCCGGC
oligo 7 c5.0.3.8 TTAGGTTGTGAGTGAATAACCTTGCTTCTGTAAATACAATTT
oligo 8 c5.0.3.9 CATTTGAGATTCGCCTGATTGCTTTGAATACCAAGAAAGAAA
oligo 9 c5.0.3.10 TTGCGTACGCGAGAAAACTTTAATAAGAATAAACACCGGAAT
oligo 10 c5.0.3.11 CATAATTAAGCCAACGCTCAATAACATTATCATTTACTAATA
oligo 11 c5.0.3.12 GATTAGAGCCGTCAATAGATAAATCAATATCTGGTGAACAAG
oligo 12 c5.0.3.13 AAAAATAACCAAGTACCGCACTCATCGAGAACAAGATCAGAT
oligo 13 c5.0.3.14 ATAGAAGCGCGAACTGATAGCTCACCAGTCACACGACCAGTA
oligo 14 c5.0.3.15 ATAAAAGCATTGCAACAGGAATCCCAATCCAAATAGACGGGA
oligo 15 c5.0.3.16 GAATTAACTGAACACCCTGAAAGTTAAGCCCAATACAGAATC
oligo 16 c5.0.3.17 CTGAGAACGCCGCTACAGGGCGCGTACTATGGTTGAAAGCGA
oligo 17 c5.0.3.18 AAGGAGCTAAAGGTGGCAACAAGACAAAAGGGCGACATTCAA
oligo 18 c5.0.3.19 CCGATTGGTCACCGACTTGAGCAACGTCAAAGGGCAAATCCT
oligo 19 c5.0.3.20 GTTTGATGGTGGTTCCGAAATGGGCAACAGCTGATCTGTCGT
oligo 20 c5.0.3.21 GCCAGCTGCATTAATGAATCGGATAGCAGCACCGTGAGCCAG
oligo 21 c5.0.3.22 CAAAATCTTTACCAGCGCCAATATAAAAGAAACGCTTACCAG
oligo 22 c5.0.3.23 AAGGAAACAATGAAATAGCAAAGGGAAGCGCATTAAGAAACG
oligo 23 c5.0.3.24 ATTTTTTAGTTGCTATTTTGCCTAAGAACGCGAGGAGAACGG
oligo 24 c5.0.3.25 GTATTAAATATCCCATCCTAAAGAATATAAAGTACTGAGAAT
oligo 25 c5.0.3.26 CGCCATATAAATAAGGCGTTATTCAAATATATTTTGAATTTA
oligo 26 c5.0.3.27 TCAAAATAATTTTCCCTTAGAATCCTTGAAAACATATGATGA
oligo 27 c5.0.3.28 AACAAACAGAGGCGAATTATTCATTTCA
oligo 28 c5.0.3.29 AACGTCACCAATGAAACCATCGCCAACGCGCGGGGGGGTGGT
oligo 29 c5.0.3.30 TTTTCTTTTCACCAGTGAGACCGGCAAAATCCCTTAGAGTCC
oligo 30 c5.0.3.31 ACTATTAACTAAATCGGAACCGAAAGGAAGGGAAGCTTTGAC
oligo 31 c5.0.3.32 GAGCACGAAAGGGATTTTAGATAGTAATAACATCAATATTAC
oligo 32 c5.0.3.33 CGCCAGCGGACATTCTGGCCAATTTTTGAATGGCTCTGCAAC
oligo 33 c5.0.3.34 AGTGCCAAATATCAAACCCTCATACATTTGAGGATCGAACGT
oligo 34 c5.0.3.35 TATTAATCCTGATTGTTTGGACGTAAAACAGAAATTTACAAA
oligo 35 c5.0.3.36 ATCGCGCATCAAGAAAACAAAATTAATTACATTTACGTCGCT
oligo 36 c5.0.3.37 ATTAATTCATAGGTCTGAGAGACTACCTTTTTAACCGCAAGA
oligo 37 c5.0.3.38 CAAAGAAGATTTTCAGGTTTATCAGATGATGGCAATTCATCA
oligo 38 c5.0.3.39 ATATAATTTTAAAAGTTTGAGCAGTAGGGCTTAATCGACAAA
oligo 39 c5.0.3.40 AGGTAAAGTAATTCTGTCCAGAATAGATAAGTCCTCAGTTGG
oligo 40 c5.0.3.41 CAAATCAGAGGTGAGGCGGTCAGTATTAACACCGCATTAGTC
oligo 41 c5.0.3.42 TTTAATGGCTTATCCGGTATTACCCAGCTACAATTTTATCCT
oligo 42 c5.0.3.43 GAATCTTAGCCATATTATTTAAAACGCTCATGGAATTAACCG
oligo 43 c5.0.3.44 TTGTAGCAATACTTCTTTGATCAGGAACGGTACGCATAAGAG
oligo 44 c5.0.3.45 CAAGAAACCGAGGAAACGCAATAATAACGGAATACAGAAAAT
oligo 45 c5.0.3.46 ACATACAGGGCGCTAGGGCGCGTTTTTTGGGGTCGAGGTGCC
oligo 46 c5.0.3.47 GTAAAGCAAGAACGTGGACTCCCATTTGGGAATTAAATCAGT
oligo 47 c5.0.3.48 AGCGACAGAATCAAGTTTGCCTCCAGTCGGGAAACTGCCCTT
oligo 48 c5.0.3.49 CACCGCCTGGCCCTGAGAGAGGCCCCAGCAGGCGAGAAAAAC
oligo 49 c5.0.3.50 CGTCTATATCACCCAAATCAATGGCAAGTGTAGCGCGCCGCG
oligo 50 c5.0.3.51 CTTAATGGTGTTTTTATAATCGTCCATCACGCAAAATACCTA
oligo 51 c5.0.3.52 CATTTTGTTACATTGGCAGATCCTAAAACATCGCCCAGAAGA
oligo 52 c5.0.3.53 TAAAACAACAGTTGAAAGGAATAGGAGCACTAACATGCGGAA
oligo 53 c5.0.3.54 CAAAGAACATATTCCTGATTAACGTCAGATGAATAGAGAAAC
oligo 54 c5.0.3.55 AATAACGATTACCTTTTTTAATGGAAAC
oligo 55 c5.0.3.56 ATCAATAGAAAATTCATATGGACCAGTAGCACCATTCCAGTT
oligo 56 c5.0.3.57 TGGAACAATAAATCAAAAGAATAGCCCG
oligo 57 c5.0.3.58 GTGTTGTTACCATT
oligo 58 c5.0.3.59 ACGCAGTAATATTG
oligo 59 c5.0.3.60 TAAGCAGATAGCCGAACAAAGAAAGACACCACGGAGGCGAAC
oligo 60 c5.0.3.61 GTGGCGACTAAAGGGAGCCCCCGATTTA
oligo 61 c5.0.3.62 GAAAGCCATAAGTT
oligo 62 c5.0.3.63 AGAGATAATGATTA
oligo 63 c5.0.3.64 CAGAGAGAATAACATAAAAACTAGCTATCTTACCGACAGGAG
oligo 64 c5.0.3.65 GCCGATTTATAACGTGCTTTCCTCGTTA
oligo 65 c5.0.3.66 GAGCTAAAAGCCCT
oligo 66 c5.0.3.67 TTTGCCAAATTGAG
oligo 67 c5.0.3.68 TTGAAGCCTTAAATCAAGATTGTTTAACGTCAAAATAATATC
oligo 68 c5.0.3.69 CAGAACACTTGCCTGAGTAGAAGAACTC
oligo 69 c5.0.3.70 TTGCTGGATGAAAA
oligo 70 c5.0.3.71 ACCGCGCGCGTCTT
oligo 71 c5.0.3.72 CTGTCTTTCCTTATCATTCCACGTTTTAGCGAACCGTGGCAC
oligo 72 c5.0.3.73 AGACAATACAGAGATAGAACCCTTCTGA
oligo 73 c5.0.3.74 AGAATACTCCCGAC
oligo 74 c5.0.3.75 AGAACGCTTTCATC
oligo 75 c5.0.3.76 CATTTTCGAGCCAGTAATAAGTTTACGAGCATGTACTTGCTG
oligo 76 c5.0.3.77 AACCTCACGCTGAGAGCCAGCAGCAAAT
oligo 77 c5.0.3.78 GCATCACGAAACCA
oligo 78 c5.0.3.79 ATACAAACAACATG
oligo 79 c5.0.3.80 TTTGAAATACCGACCGTGTGATTTAACAACGCCAATTAAATC
oligo 80 c5.0.3.81 CTTTGCCTTAGAAGTATTAGACTTTACA
oligo 81 c5.0.3.82 ACTCGTACATGTAA
oligo 82 c5.0.3.83 AAATGCTGTTTAGT
oligo 83 c5.0.3.84 ACGCTGAGAAGAGTCAATAGTAGTTAATTTCATCTCAAAATT
oligo 84 c5.0.3.85 ATTTGCATTATACTTCTGAATAATGGAA
oligo 85 c5.0.3.86 ACCATATTCTGACC
oligo 86 c5.0.3.87 AATATATGGGTTAT
oligo 87 c5.0.3.88 AAAGAAGAGCGATA
oligo 88 c5.0.3.89 ACATCGGTACAGTA
oligo 89 c5.0.3.90 TTATCATACCACCA
oligo 90 c5.0.3.91 ATATCTTTTGAGGA
oligo 91 c5.0.3.92 CCACCAGATTAAAA
oligo 92 c5.0.3.93 GGATTATACGCTCA
oligo 93 c5.0.3.94 AGAGTCTAGTGAGG
oligo 94 c5.0.3.95 CCACACCGTCACGC
oligo 95 c5.0.3.96 GTGAACCCAGGGCG
oligo 96 c5.0.3.97 CTGGTTTTTGCAGC
oligo 97 c5.0.3.98 GGCGCCAAGAGGCG
c5.0.4: barrel oligos @ outside aptamers -aptamers
oligo 7 c5.0.4.1 ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGC
oligo 43 c5.0.4.2 GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAAC
oligo 65 c5.0.4.3 TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAA
oligo 75 c5.0.4.4 ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCA
oligo 78 c5.0.4.5 GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCA
c5.0.5: barrel oligos @ inside aptamers -aptamers
oligo 33 c5.0.5.1 GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAAT
oligo 67 c5.0.5.2 ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTA
oligo 89 c5.0.5.3 TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACAT
oligo 95 c5.0.5.4 AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACG
oligo 104 c5.0.5.5 TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGAC
c5.0.6: barrel oligos @ top latches -latches
oligo 60 c5.0.6.1 CCGCCTCGACGACGACAATAAATTCTTACCAGTATAAAGCCA
oligo 84 c5.0.6.2 GCATCGGCCTACATTTTGACGACCGCCAGCCATTGCAACAGG
oligo 86 c5.0.6.3 GAGAAAGCCCCAAAAACAGGAGTAAACGTTAATATGGATTCT
c5.0.7: barrel oligos @ bottom latches -latches
oligo 30 c5.0.7.1 GCCCTTTATAATAAGAGCAAGCAAAAATGAAAATATTATCCC
oligo 108 c5.0.7.2 ATTTTAAAACACCAGAACGAGCAGGCGAAAATCCTTGGACTC
oligo 139 c5.0.7.3 TTTGAGTACCTACCATATCAAAATTATT
c5.0.8: barrel outward biotinylated oligos
oligo 7 c5.0.8.1 ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGCTTT-biotin
oligo 43 c5.0.8.2 GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAACTTT-biotin
oligo 65 c5.0.8.3 TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAATTT-biotin
oligo 75 c5.0.8.4 ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCATTT-biotin
oligo 78 c5.0.8.5 GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCATTT-biotin
c5.0.9: barrel inward biotinylated oligos
oligo 33 c5.0.9.1 GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAATTTT-biotin
oligo 67 c5.0.9.2 ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTATTT-biotin
oligo 89 c5.0.9.3 TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACATTTT-biotin
oligo 95 c5.0.9.4 AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACGTTT-biotin
oligo 104 c5.0.9.5 TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGACTTT-biotin


Program Output

oligo path
oligo token list

Sorted Oligos

lid1 oligo sequence list
lid2 oligo sequence list
barrel oligo sequence list