New pages
From OpenWetWare
Jump to navigationJump to search(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 11:45, 17 January 2021 Cornell SciFi Lab:Lab Members (hist | edit) [16,776 bytes] TianlinZhao (talk | contribs) (Created page with "400px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> Cornell SciFi Lab | <font face="trebuchet ms" style="...")
- 23:04, 13 January 2021 Fungi in composite organisms (hist | edit) [186 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Some fungi are components of composite assemblages of organisms, often from different kingdoms of life. Lichens are a great understudied example of of these types of composite...")
- 22:42, 13 January 2021 Holobiont Fungi (hist | edit) [145 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Holobionts are composite assemblages of organisms, often from different kingdoms of life. Lichens are a great understudied example of holobionts.")
- 22:39, 13 January 2021 Polymorphic Fungi (hist | edit) [137 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Some fungi can switch between a unicellular state and a multicellular state, such as the human pathogen Candida albicans. ...")
- 22:28, 13 January 2021 Unicellular Fungi (hist | edit) [269 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Bakers yeast, Saccharomyces cerevisae is a great example of a unicellular fungus. Under certain conditions S. cerevisae can be coaxed to take on a filamentous morphology. Un...")
- 18:08, 11 January 2021 Molds (hist | edit) [98 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Various moulds, from bead moulds to plant pathogens. Neurospora crassa Aspergillus niger")
- 18:06, 11 January 2021 Multicellular Fungi (hist | edit) [135 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Proposed arbitrary groupings below: *wood-degrading fungi *moulds *ectomycorrhiza fungi *arbuscular mycorrhiza fungi")
- 18:04, 11 January 2021 Fungal Organisms (hist | edit) [273 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "*Unicellular Fungi *Multicellular Fungi *Polymorphic Fungi")
- 22:09, 10 January 2021 Media recipes (hist | edit) [526 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "{| class="wikitable" |+ style="caption-side:top; |''PDY'' |- ! style="color:black" | Component ! style="color:black" | Grams |- |Orange |Butter |- |Pear |Pie |- |Apple |Ice cr...")
- 19:39, 8 January 2021 Mycotronics (hist | edit) [859 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "thumb|center|upright=2 <gallery widths=400px heights=300px perrow=2 mode="nolines"> File:mycotronics2.png | File:mycotronics3.png | File:mycotro...")
- 23:51, 5 January 2021 Aerobic solid-state fermentation (hist | edit) [307 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "<gallery widths=400px heights=400px mode="nolines"> File:syringesolid.png | Spores syringes and artisanal grow equipment. File:jarsolid.png | Characterizing substrate particle...")
- 23:45, 5 January 2021 Liquid-based culture (hist | edit) [60 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "thumb|center|upright=2|R. Perez 2020")
- 23:42, 5 January 2021 Plate-based tissue culture (hist | edit) [133 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "R. Perez et al. 2020")
- 23:07, 5 January 2021 Antifungal selection (hist | edit) [771 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "There are many antifungal selection markers that are reported in the literature; two that I have used so far are carboxin and hygromycin B. In my hands, G. lucidum 10597-SS1 w...")
- 21:19, 4 January 2021 Laboratory Culture Protocols (hist | edit) [875 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "The preferred laboratory media for culturing G. lucidum 10597-SS1 with plate-based and liquid-based methods are potato dextrose yeast extract (PDY) or our custom media, mushro...")
- 21:02, 4 January 2021 Liquid-based Agrobacterium-mediated transformation (hist | edit) [602 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Content forthcoming.")
- 21:01, 4 January 2021 Plate-based Agrobacterium-mediated transformation (hist | edit) [604 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Content forthcoming.")
- 21:00, 4 January 2021 Ganoderma hybrid assembly (hist | edit) [20 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Content forthcoming.")
- 21:00, 4 January 2021 Ganoderma nanopore seq (hist | edit) [20 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Content forthcoming.")
- 20:57, 4 January 2021 Nucleic Acid Sequencing Protocols (hist | edit) [104 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Content forthcoming.")
- 20:23, 4 January 2021 Myco-Metrology Kit (hist | edit) [5,975 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "===Myco-Metrology Kit v1 Instruction Manual=== Hello Intrepid Explorer, You are the lucky recipient of an experimental MycoKit. Have a quick look at this video for an overvi...")
- 08:33, 4 January 2021 Beauchamp:DownloadDataPenn (hist | edit) [3,229 bytes] John Magnotti (talk | contribs) (Downloading data from the ieeg.org portal)
- 23:27, 3 January 2021 Linear fragment delivery using PEG-mediated transformation (hist | edit) [3,539 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "I intended this protocol to be used for transient expression experiments using linear amplicons of expression cassettes. #Inoculate 50 mL PDY or MPDY in a 125 mL flask with 9...")
- 23:20, 3 January 2021 Plasmid delivery using PEG-mediated transformation (hist | edit) [3,539 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "#Inoculate 50 mL PDY or MPDY in a 125 mL flask with 9 plugs of leading edge tissue. Culture at 30C, 70 rpm for 5 days. #Prepare 15ml of lysing enzymes (0.2g into 5ml) and incu...")
- 23:17, 3 January 2021 Protoplast Production (hist | edit) [3,512 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "#Inoculate 50 mL PDY or MPDY in a 125 mL flask with 9 plugs of leading edge tissue. Culture at 30C, 70 rpm for 5 days. #Prepare 15ml of lysing enzymes (0.2g into 5ml) and incu...")
- 22:52, 3 January 2021 Genomic DNA Isolation and Purification (hist | edit) [6,169 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Adapted from Invitrogen ChargeSwitch gDNA Plant Kit protocol: [https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2F...")
- 22:10, 3 January 2021 Moulds (hist | edit) [0 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Various moulds, from bead moulds to plant pathogens. Neurospora crassa Aspergillus niger")
- 21:55, 3 January 2021 Plasmid delivery using electroporation (hist | edit) [2,572 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Adapted from [https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0043737&type=printable The Development and Application of a Multiple Gene Co-Silencing Sys...")
- 21:06, 3 January 2021 Primers for Ganoderma lucidum (hist | edit) [5,974 bytes] Rolando Cruz Perez (talk | contribs) (Created page with " Name Sequence (5'->3') Comments * pHg_LB_For(sequencing) TGGTGGCAGGATATATTGTGGTGTAAACA This is to amplify the T-DNA region in pHg (or any pCAMBIA-1300 based vector)...")
- 21:03, 3 January 2021 Synthetic genes for Ganoderma lucidum (hist | edit) [2,354 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "*NanoLuc_codonopt_Ganoderma ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGC...")
- 20:59, 3 January 2021 Primers gano (hist | edit) [6,451 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "ordered received Name Sequence (5'->3') Comments EXAMPLE --- HA1 CTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATG Homology arm at insertion site in GFP (forward strand)...")
- 20:57, 3 January 2021 Synthetic genes gano (hist | edit) [3,302 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "06/20 ordered received name sequence note mRFP_codonopt_Ganoderma * * ATGGCCAGCAGCGAGGACGTCATTAAGGAGTTCATGCGCTTCAAGGTCCGTATGGAGGGTTCCGTTACCGTTACCTCTTCGAAGTCGAAAGTCAAAG...")
- 20:00, 3 January 2021 Transformation Protocols (hist | edit) [409 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Agrobacterium-mediated transformations Plate-based Agrobacterium-mediated transformation Liquid-based Agrobacterium-mediated transformation Polyethylene glycol (PEG)...")
- 15:10, 29 December 2020 Biomaterials: Culture Samples, Plasmids, Agrobacterium strains (hist | edit) [2,741 bytes] Rolando Cruz Perez (talk | contribs) (Created page with "Synthetic genes for use in Ganoderma lucidum 10597-SS1 were produced using [https://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=5315 this] codon table. Regulatory seq...")
- 14:52, 29 December 2020 Ganoderma lucidum 10597-SS1 (hist | edit) [956 bytes] Rolando Cruz Perez (talk | contribs) (Page for Ganoderma lucidum 10597-SS1)
- 12:44, 29 December 2020 Wood-degrading fungi (hist | edit) [2,034 bytes] Rolando Cruz Perez (talk | contribs) (A focus on fungi that eat wood.)
- 12:41, 29 December 2020 Synthetic mycology (hist | edit) [2,070 bytes] Rolando Cruz Perez (talk | contribs) (Launch pad for enabling bioengineering frontiers for mycology, synthetic mycology.)
- 12:27, 28 December 2020 Beauchamp:DrawingROIs (hist | edit) [1,809 bytes] Michael S Beauchamp (talk | contribs) (Created page with "{{Beauchamp Navigation Bar}} <br> How to draw ROIs on the surface for fMRI analysis using SUMA")
- 17:32, 21 December 2020 Nida Patel Journal Week 11 (hist | edit) [2,033 bytes] Nidapatel (talk | contribs) (finished week 11 purpose, template, and methods)
- 14:18, 21 December 2020 Peyton:Lab Meeting Schedule Spring 2021 (hist | edit) [668 bytes] Speyton (talk | contribs) (Created page with "{{Peyton Top}} {| |- valign="top" |width=740px class="MainPageBG" style="border: 5px solid #330000; color: #000000; background-color: #FFFFFF"| <div style="padding: .4em .9e...")
- 07:08, 19 December 2020 HRV:Cardiorespiratory Monitors (hist | edit) [37,310 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 07:08, 19 December 2020 HRV:HRV (hist | edit) [15,269 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 07:08, 19 December 2020 HRV:ECG (hist | edit) [6,439 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 07:08, 19 December 2020 HRV:Monitoring Parameters in the ICU (hist | edit) [20,805 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 07:08, 19 December 2020 HRV:Physiological Systems (hist | edit) [11,718 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 11:54, 18 December 2020 Silver: 2021 Meeting Schedule (hist | edit) [251 bytes] PamSilver (talk | contribs) (Created page with "==January==")
- 11:46, 10 December 2020 JT Correy Journal Week 14 (hist | edit) [1,998 bytes] Jcorrey (talk | contribs) (made page)
- 08:49, 10 December 2020 HRV:Abbreviations (hist | edit) [3,170 bytes] Rjvickery (talk | contribs) (Created page with "150px <div style="padding: 10px; color: #ffffff; background-color: #000; width: 730px"> <center> HRV | <font face="trebuchet ms" style="color:#ffffff">...")
- 23:16, 9 December 2020 BIOL368/S19 Week 14 (hist | edit) [1,646 bytes] Falghane (talk | contribs) (mutant week 14)
- 21:29, 4 December 2020 BIOL368/F20:Class Journal Week 14 (hist | edit) [15,715 bytes] Anna Horvath (talk | contribs) (Added Anna Horvath journal post)
