Mpaniag1 Week 6

From OpenWetWare
Jump to navigationJump to search

Purpose

The purpose of this week's lab is to answer the question, can moderate and rapid progressors can be categorized in the same group?

Experiment

Question

Can moderate and rapid progressors be categorized in the same group?

Hypothesis

Yes, moderate and rapid progressors can be categorized together, due to the fact there was no statistical significance between the two groups

Methods

  • Used Rapid and Moderate progessors
  • Eliminated Subjects 1, 4, and 7 from the data set
    • Eliminated Subject 1 because of lack of visit at two year mark
    • Eliminated Subjects 4 and 7 because they were the only two subjects that had above 1000 CD4 count to begin with
  • Chose three clones for each subject for both the 1st Visit and approximately 2 Year Visit
    • Used random number generator [1] to choose what clones were studied
  • Calculated theta for 1st visit and for 2 Year visit and compared the difference between the two
    • Counted nucleotide differences between the three clones for a subject at either the first or 2 year visit
    • Used the harmonic sum calculator to find the value that is in the denominator of the formula [2]
  • Calculated if there is any significance between the moderate and rapid progressors in regard to theta difference between 2 years by doing a T test (see more detailed methods below)

1st Visit Clones

Table 1-1st Visit
Subject Clone #
3 (Rapid) 1
2
4
5 (Moderate) 1
2
4
6 (Moderate) 1
2
3
8 (Moderate) 2
4
5
9 (Moderate) 3
4
5
10 (Rapid) 2
4
5
11 (Rapid) 4
5
7
14 (Moderate) 3
5
6
15 (Rapid) 2
5
8

2 Year Visit Clones

Table 2-2 Year Visit
Subject Clone #
3 (Rapid) 1
6
8
5 (Moderate) 2
5
6
6 (Moderate) 2
7
9
8 (Moderate) 1
3
4
9 (Moderate) 2
5
6
10 (Rapid) 5
6
9
11 (Rapid) 1
6
9
14 (Moderate) 2
4
6
15 (Rapid) 6
7
9

Results-Trees

Phylogenetic Tree Subject 3

Phylogenetic Tree-Subject Three MAP.PNG

Figure 1-Subject 3, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 5

PT Subject 5 MAP.PNG

Figure 2-Subject 5, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 6

PT subject 6 MAP.PNG

Figure 3-Subject 6, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 8

PT subject 8 MAP.PNG

Figure 4-Subject 8, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 9

PT subject 9 MAP.PNG

Figure 5-Subject 9, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 10

Mksubject10.PNG

Figure 6-Subject 10, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 11

Mktreesubject11.PNG

Figure 7-Subject 11, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 14

Mktreesubject14.PNG

Figure 8-Subject 14, Clones from 1st Visit and 2 Year Visit

Phylogenetic Tree Subject 15

Mktreesubject15.PNG


Figure 9-Subject 15, Clones from 1st Visit and 2 Year Visit

Results-Alignments and Thetas

Subject 3 1st Visit

S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
                *********** *************** ** *****************************
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ***************************************************** ******
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ************************************************************
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                ************************************************************
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
                **************************** ****************
Table 3
Subject Number of Clones S Theta
3 3 5 2.73

Subject 3 2 Year Visit

S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                *************************** ******************** ***********
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ************************************************************
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ************* **********************************************
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                *************************************** ********************
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                *********************************************
Table 4
Subject Number of Clones S Theta
3 3 4 2.18

Subject 5 1st Visit

S5V1-1          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAGTAGTACATCTA
S5V1-4          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-2          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
                ************************************************ ***********
S5V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
                ************************************************************
S5V1-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                ************************************************************
S5V1-1          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-4          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
                ************************************************************
S5V1-1          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATCCATCCTCA
S5V1-4          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATTCATCCTCA
S5V1-2          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATCCATCCTCA
                ************************************ ********
Table 5
Subject Number of Clones S Theta
5 3 2 1.09

Subject 5 2 year Visit

S5V4-5          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-2          GAGGTAGTAATTAGATCTCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-6          GAGGTAGTAATTAGATCTCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
                *****************   **** ***********************************
S5V4-5          AATGAATCTGTAGAAATTAATTGCACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
                *********************** ************************************
S5V4-5          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-2          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCG
S5V4-6          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                ***** ***************************************************** 
S5V4-5          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGTTATAAAATTA
S5V4-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V4-6          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
                *********************************** ************* **********
S5V4-5          AGAGAACAATTTAAGAATAAAACAATAGTATTTAAGTCATCCTCA
S5V4-2          AGAGAACAATTTGAGAATAAAACAATAGTATTTAATTCATCCTCA
S5V4-6          AGAGAACAATTTGAGAATAAAACAATAGTATTTAATTCATCCTCA
                ************ ********************** *********
Table 6
Subject Number of Clones S Theta
5 3 9 4.91

Subject 6 1st Visit

S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
                ************************* ******************************** *
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
                ************************************************************
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
                ************************************************************
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
                *******************************    *************************
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
                ******  *************************************
Table 7
Subject Number of Clones S Theta
6 3 8 4.36

Subject 6 2 year Visit

S6V5-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-7          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
                ********************************************************** *
S6V5-9          AATGAACTTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
                ******  ****************************************************
S6V5-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGACAAGCA
                *********************************** ************************
S6V5-9          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-7          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
                ********************** ********    *************************
S6V5-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-7          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
                **************************** ****************
Table 8
Subject Number of Clones S Theta
6 3 9 4.91

Subject 8 1st Visit

S8V1-2          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V1-4          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V1-5          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
                ************************************************************
S8V1-2          AATGAATCTGTAGAGATGAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATATCT
S8V1-4          AATGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
S8V1-5          AATGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
                ***************************** ******************************
S8V1-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S8V1-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S8V1-5          ATAGGACCAGGCAGAGCACTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
                ****************** *****************************************
S8V1-2          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V1-4          CATTGTAGCCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V1-5          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
                ******* ****************************************************
S8V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S8V1-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S8V1-5          AGAGAACAATTTAAGAATAAAACGATAGTCTTTAATCAATCCTCA
                *********************** *********************
Table 9
Subject Number of Clones S Theta
8 3 4 2.18

Subject 8 2 Year Visit

S8V4-3          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V4-1          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
S8V4-4          GAGGTAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAGTCATAATAGTACATCTG
                ************************************************************
S8V4-3          AAAGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S8V4-1          AAAGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
S8V4-4          AAAGAATCTGTAGAGATGAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
                *********************************************** ************
S8V4-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGGGAAATAATAGGAGATATAAGACAAGCA
S8V4-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S8V4-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACATGCA
                ******************************** *********************** ***
S8V4-3          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V4-1          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
S8V4-4          CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAAAATATAGCTATAAAATTA
                ************************************************************
S8V4-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S8V4-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S8V4-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
                *********************************************
Table 10
Subject Number of Clones S Theta
8 3 3 1.64

Subject 9 1st Visit

S9V1-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V1-4          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V1-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
                ************************************************************
S9V1-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-4          AAAGAACATGTAGAAATAAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
                *********************** ************************************
S9V1-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-4          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
                ************************************************************
S9V1-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-4          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-5          CATTGTAACATTAGTGGAGCAAAATGGAAGGACACCTTAAAACAGATAGTTGAAAAATTA
                ***************************** ******************************
S9V1-3          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-4          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-5          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
                * *******************************************
Table 11
Subject Number of Clones S Theta
9 3 3 1.64

Subject 9 2 Year Visit

S9V5-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-2          GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V5-6          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
                ********* **************************************************
S9V5-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-2          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V5-6          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
                ************************************************************
S9V5-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V5-2          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S9V5-6          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGGCAAGCA
                *********************************  ****************** ******
S9V5-5          CATTGTAACATTAGTGGAGTAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA
S9V5-2          CATTGTAACGTTAGTGGAGCAAAATGGCATAACACCTTAAAACAGATAGTTGAAAAATTA
S9V5-6          CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA
                ********* ********* ******* ** ****************** **********
S9V5-5          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-2          AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V5-6          AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
                * ********** ********************************
Table 12
Subject Number of Clones S Theta
9 3 11 6.00

Subject 10 1st Visit

S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                *************************************************** ********
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
                ********************* **************************************
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
                ***** ************** ***************************************
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
                ************************************************************
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
                *******************************************
Table 13
Subject Number of Clones S Theta
10 3 4 2.18

Subject 10 2 year Visit

S10V4-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                ************************************************************
S10V4-5         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGCATACAT
S10V4-6         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAACACAAGAAGAAGAATAAGT
S10V4-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
                *** ** ********************************** *********** ***  *
S10V4-5         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-6         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-9         ATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
                **************** *** *** ********** ************************
S10V4-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-9         CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAATTA
                *************************** ********************************
S10V4-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAAGCAATCCTCA
S10V4-6         AGGGAACAATTTAGGAATAAAACAATAATCCTTAATCAATCCTCA
S10V4-9         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
                ** *************************** **** *********
Table 14
Subject Number of Clones S Theta
10 3 14 7.64

Subject 11 1st Visit

S11V1-4         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-7         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ****************** *****************************************
S11V1-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
                ************************************************************
S11V1-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                ************************************************************
S11V1-4         CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA
S11V1-7         CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA
                ***************   ********* *********************** ********
S11V1-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
                ************************************************
Table 15
Subject Number of Clones S Theta
11 3 6 3.27

Subject 11 2 Year Visit

S11V4-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ************************************************************
S11V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
                ************************************ ***********************
S11V4-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V4-9         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                ********************************************* **************
S11V4-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA
S11V4-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
                **************************************************** *******
S11V4-6         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-1         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-9         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
                ************** *  ******************************
Table 16
Subject Number of Clones S Theta
11 3 6 3.27

Subject 14 1st Visit

S14V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S14V1-6         GAGGTAGTAGTTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S14V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ********* **************************************************
S14V1-5         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S14V1-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S14V1-3         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
                ************************************************************
S14V1-5         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGGCAAGCA
S14V1-6         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGGCAAGCA
S14V1-3         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGGCAAGCA
                ************************************************************
S14V1-5         CATTGTAACCTTAGTAGAGCAAAATGGAATGACGCTTTAAAACAGATAGTTTACAAATTA
S14V1-6         CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAACAGATAGTTTACAAATTA
S14V1-3         CATTGTAACCTTAGTAGGGCAAAATGGAATGACACTTTAAAACAGACAGTTTACAAATTA
                ***************** *************** ************ *************
S14V1-5         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
S14V1-6         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
S14V1-3         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
                ************************************************
Table 17
Subject Number of Clones S Theta
14 3 4 2.18

Subject 14 2 Year Visit

S14V5-2         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S14V5-4         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAACAGTACAGCTG
S14V5-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ************************************************* **********
S14V5-2         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S14V5-4         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S14V5-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
                ************************************************* ******* **
S14V5-2         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGGCAAGCA
S14V5-4         ATAGGACCAGGGAGAGCGTTGTATGCAACAGGAGCTATAATAGGAGATATAAGGCAAGCA
S14V5-6         ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCTATAATAGGAGATATAAGGCAAGCA
                ***************** ** ************   ************************
S14V5-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAACAGATAGTTTACAAATTA
S14V5-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAACAGATAGTTTACAAATTA
S14V5-6         CATTGTAACCTTAGTAGAGCAAAATGGAATGACACTTTAAAACAGATAGTTTACAAATTA
                ************************************************************
S14V5-2         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
S14V5-4         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
S14V5-6         AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
                ************************************************
Table 18
Subject Number of Clones S Theta
14 3 8 4.36

Subject 15 1st Visit

S15V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-2         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                * *************************************** ************** ***
S15V1-5         AATAAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-2         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-8         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACCT
                **  ** *****  *************************************** **** *
S15V1-5         ATAGGACCAGGGAGCGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S15V1-2         ATAGGACCAGGGAAAACATTTTATACAGGAGACATAATAGGAGATATAAGGCAAGCACAT
S15V1-8         ATGGGACCAGGGAAAGCATTTTATACAGGAGAGATAATAGGAGATATAAGGCAAGCACAT
                ** **********   ***********  **  ***************************
S15V1-5         TGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTAAGA
S15V1-2         TGTAACATTAGTAGATCAAATTGGAATAGCACTTTAAAACAGATAGTTAACAAATTAAGA
S15V1-8         TGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTAAGA
                ************* * ** * ******  *******************************
S15V1-5         GAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-2         GAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-8         GAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
                ************************ * ******** ******
Table 19
Subject Number of Clones S Theta
15 3 27 14.7

Subject 15 2 Year Visit

S15V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
                ************************************************************
S15V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGGATACAT
S15V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
                ***************************************************  *******
S15V4-6         ATAGGACCAGGGAAAACATTTTATACAGGAGACATAATAGGAAATATAAGGCAAGCACAT
S15V4-9         ATAGGACCAGGGAAAACATTTTATACAGGAGACATAATAGGAAATATAAGGCAAGCACAT
S15V4-7         ATAGGACCAGGGAAAACATTTTATACAGGAGACATAATAGGAAATATAAGGCAAGCACAT
                ************************************************************
S15V4-6         TGTAACATTAGTGAGTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTAACA
S15V4-9         TGTAACATTAGGGGTTCAAAATGTAATAACACTTTAAAACAGATAGTTAACAAATTAAGA
S15V4-7         TGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTAAGA
                *********** *  ******** ********************************** *
S15V4-6         GAACAATTGGAGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-9         GAACAATTTGGGAATAAAACAATAATCGTTAATCAATCCTCA
S15V4-7         GAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
                ******** * ************* ** **************
Table 20
Subject Number of Clones S Theta
15 3 11 6.00

Final Theta Comparison

Table 21
Subject Theta Initial Theta Final
3 2.73 2.18
5 1.09 4.91
6 4.36 4.91
8 2.18 1.64
9 1.64 6.00
10 2.18 7.64
11 3.27 3.27
14 2.18 4.36
15 14.7 6.00

Statistic Tests

  • To see if there was significance between the rapid and moderate progressors, an F test was conducted, followed by a T-test. Instructions for how to do this in Excel were from T-test protocol.
  • The theta differences between the first visit and the 2-year visit are below

Mkdataforstatisticaltests.JPG

  • An F test was run first to test the null hypothesis, that variances of the two progressor populations are equal
    • Clicked on Data Analysis tab->F test 2 Samples for Variance
    • Variance 1=Rapid progressor Data
    • Variance 2=Moderate progressor Data
    • If F>F critical one tail we reject the null hypothesis
      • The results obtained were 7.81>6.59, which means we can reject the null hypothesis and proceed with the T-test

Ftestmking.JPG

  • A T-test was performed, if the p-value is below 0.05 the data is significant and the two groups can be categorized differently
    • Clicked on the Data analysis tab->t-test: 2 samples Assuming Unequal Variance
    • Variable 1=Rapid progressor Data
    • Variable 2=Moderate progressor Data
  • If t Stat < -t Critical two-tail OR if t-stat > t Critical two-tail, we reject the null hypothesis
    • The results obtained were -0.986<-2.776 or -0.986>2.77., which means we cannot reject our null hypothesis

Mkingttestconclusion.JPG

  • Therefore, rapid and moderate progressors do not belong in the same group
  • The lack of significance could have been due to the huge difference in variance, future studies could make the cohort larger and maybe get a significant p-value.

Conclusion

In conclusion, Markham et al.'s study put rapid and moderate progressors in their own distinct groups. However, when the data was cleaned and inconsistent subjects were removed from the data analyzed no significance was found. Therefore, rapid and moderate progressors should be in the same group.

Data and Files

Phylogenetic trees of all the subjects studied are linked below. Subjects 3-9 were made by me Subjects 10-15 were made Madeleine B. King

Stats were ran by Madeleine B. King

Stats including Ttest and F test results in Zip file below and images, made by Madeleine B. King

Acknowledgments

  • I worked with my homework partner, Madeleine B. King, and Nathan On throughout the class and compared techniques to become more efficient in the data analysis
  • I worked with Madeleine B. King three times outside of class to figure out the details in our research project presentation
  • Madeleine B. King and I went to Kam D. Dahlquist, Ph.D. for assistance on our project on February 26, 2020
  • I copied and modified the protocol shown in the Week 6 page
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source

Mpaniag1 (talk) 19:41, 26 February 2020 (PST)

References

Finalized Project (PDF)

File:Bioinformatics Presentation MAP1.pdf

Classwork

Assignments

Journals

Class Journals