Mpaniag1 Week 5

From OpenWetWare
Jump to navigationJump to search

Purpose

The purpose of this activity is to analyze the data from the paper, 'Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline', and discover similarities and differences between the sequences from a subset of subjects I have chosen

Methods and Results Activity 1

Part 1

  • Followed Link on Week 5 assignment page to PubMed's website [1]
  • In the search bar, searched the title of the paper of interest, in this case, Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline
  • Another way you can search for the paper of interest is searching by the author's name or subject
  • Clicking on the paper will take you to the abstract of the paper itself and the figures from the paper, on the side bar PubMed has two links for full text of the article, similar articles, all the articles that cited this paper, related information in MedGen, nucleotide sequences, protein sequences, taxonomy, references from this paper, search details, and recent activity
  • Clicked on Nucleotide link in related information [2]

Part 2

  • Clicked on link to HIV-1 subject 1 visit 1 clone 9 [3]
  • Ascension #-AF016768
  • Subject-1
  • How to Find Source-Under features, the sub header, source, leads you to the information about the subject
  • Downloaded five sequences, subject 1, visit 1 clone 9; subject 2, visit 4 clone 2; subject 3, visit 5 clone 6; subject 3, visit 4 clone 8; subject 12, visit 4 clone 1
  • Clicked send to-->complete record-->file-->FASTA, create file (give it a descriptive name so it is easy to find later)
  • Opened the files in notebook, copy and paste them to the webpage
  • Sequence for Subject 1, Visit 1 clone 9
    • >AF016768.2 HIV-1 subject 1 visit 1 clone 9 from USA, envelope glycoprotein V3 region (env) gene, partial cds
GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACGGCTGAATGAATCTG
TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATAGGACCAGGTAGAGCATT
TTATACAACAGGAGACATAATAGGAGATATAAGACAAGCATATTGTAACATTAGTAGAGCAGAATGGAAT
AACACTTTAAAACAGATAGTTATAAAATTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACT
CCTCA
  • Sequence for HIV-1 subject 2, visit 4 clone 2
    • >AF016818.2 HIV-1 subject 2, visit 4 clone 2 from USA, envelope glycoprotein V3 region (env) gene, partial cds
GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTAAATGAATCTG
TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATAAGACCAGGTAGAGCATT
TTATACAACAAGAGACATAATAAGAGATATAAGACAAGCATATTGTAACATTAGTAGAGCAGAATGGAAT
AACACTTTAAAACAGATAGTTATAAAATTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACT
CCTCA
  • Sequence from HIV-1 subject 3, visit 5 clone 6
    • >AF089137.1 HIV-1 isolate S3V5-6 from USA envelope glycoprotein (env) gene, partial cds
GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTGAATGAAACTG
TAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACTCTAGGACCAGGCAGAGTATA
CTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAACCTTAGTAGAGCAGGTTGGACT
AACACTTTAGAAAGGATAGCTATAAAATTAAGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAAT
CCTCA
  • Sequence from HIV-1 subject 3, visit 4 clone 8
    • >AF089130.1 HIV-1 isolate S3V4-8 from USA envelope glycoprotein (env) gene, partial cds
GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTGAATGAAACTG
TAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACTCTAGGACCAGGCAAAGTATA
CTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAACCTTAGTAGAGCAGGTTGGAAT
AACACTTTAAAAAGGATAGCTATAAAATTAAGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAAT
CCTCA
  • Sequence from HIV-1 subject 12, visit 4 clone 1
    • >AF089542.1 HIV-1 isolate S12V4-1 from USA envelope glycoprotein (env) gene, partial cds
GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTAAATGAGACTG
TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCTATAGGACCAGGCAGAGCATT
TTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCACATTGTACCCTTAGTAGAGCAAAATGGAAT
GAAACTTTAAAACAGATAGTTATAAAATTAAAAGAACAATTTAGGAATAAGACAATAGTCTTTAGTCCAT
CCTCA

Part 3

  • Went to Phylogeny Website [4]
  • Clicked on phylogeny analysis-->One click
  • Copied and pasted the text files for each sequence used in Part 2
  • Clicked Submit
  • Clicked on Tab, Alignment
  • Clicked on outputs, chose the clustal format option
  • Copied and pasted that data below
  • For the phylogenetic tree, went back to the page that shows up after you click submit, chose Tree Rendering tab this time
  • Used Snip tool to take a screenshot of the tree produced, and saved it with a descriptive name
  • Uploaded image to wiki page
  • Compared the sequences' differences to the makeup of the tree

Alignment

AF089130.1      GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
AF089137.1      GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
AF089542.1      GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
AF016818.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
AF016768.2      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACGGCTG
                ** **************    ****** ** * ********** **** ****** *** 
AF089130.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089137.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089542.1      AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
AF016818.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016768.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                *****  ****** *** ***************  ******************  **  *
AF089130.1      CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF089137.1      CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF089542.1      ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
AF016818.2      ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGATATAAGACAAGCA
AF016768.2      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 ** ******* * ** **  ********* ** * ****** *********** *****
AF089130.1      CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
AF089137.1      CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
AF089542.1      CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
AF016818.2      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF016768.2      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ****** * ***********   **** * * ****** **  ***** **********
AF089130.1      AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
AF089137.1      AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
AF089542.1      AAAGAACAATTTAGGAATAAGACAATAGTCTTTAGTCCATCCTCA
AF016818.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016768.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                * ****** ***  *****  ************* **  ******

MAP Phylo Tree 021320.PNG

Figure 1:Phylogenetic Tree-Activity 1, Part 3

Methods and Results Activity 2

Methods Activity 2 Part 1

  • Downloaded two files with the different subjects and their clones
  • Chose Subjects 1,3,5, and 7, and clones 1,2, and 3 for each
  • Generated a multiple sequence alignment with the 12 sequences with Phylogeny website [5]
    • Clicked on Phylogeny Analysis, then One Click
    • Pasted the sequences in-->clicked submit
    • Clicked on Alignment tab
    • Copied and pasted data below
  • Generated a phylogenetic tree from the sequences chosen
    • Clicked on Tree Rendering tab
    • Used snip tool
    • Saved with a descriptive name
    • Uploaded to wiki

Results Part 1

Alignment

S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S7V1-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V1-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-2          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S5V1-3          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-1          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAGTAGTACATCTA
S5V1-2          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                **  *************    *** ** ** ***** **** * **** ******* ** 
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S7V1-3          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V1-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-2          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACTT
S5V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                **** * ****** *** ******** ******  ************ * ***  **  *
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S7V1-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGGAATATAAGACAAGCA
S7V1-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S5V1-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGACATAAGACAAGCA
S5V1-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-2          ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S1V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 ** ******* * ** **  **  * ****** * ****** *  * ****** *****
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S7V1-3          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S5V1-3          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-1          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S1V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-1          TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ******** *** *  ** * * *** ** * *********  ***** ** *******
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S7V1-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-2          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S5V1-3          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATTCATCCGCA
S5V1-1          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATCCATCCTCA
S5V1-2          AGAGAACAATTTGGGAATAAAACAATAGTATTTAATCCATCCTCA
S1V1-2          AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** **** ***  **************  ******   **  **

MAP Activity 2 tree.PNG

Figure 2-Phylogenetic Tree-Activity 2, Part 1

Table 1
Subject Clone #
1 1
2
3
3 1
2
3
5 1
2
3
7 1
2
3
  • Do the clones from each subject cluster together?
    • For this exercise I chose subjects 1,3,5,and 7 and the clones 1,2, and 3 for each. The tree shows that the clones from each subject are clustered together.
  • Do some subjects' clones show more diversity than others?
    • Clones from Subjects 7 and 3 are more diverse because there is more splitting, for 7 clone 2 is split off from 3 and 1, and for 3 clone 1 is split off from 2 and 3
  • Do some of the subjects cluster together?
    • No, each subject and its clones have their own clusters.
  • Write a brief description of your tree and how you interpret the clustering pattern with respect to the similarities and potential evolutionary relationships between subjects' HIV sequences.
    • In the tree that was generated from my chosen Subjects, each subject's clones clustered together, the only difference was subject 3 and 7 had one clone from their set branch differently. Based on this data it can be hypothesized that each subject's clones are similar with minute differences, starting from a similar place. The potential evolutionary relationship is hypothesized that HIV evolves similarly even within different subjects.

Methods for Activity 2 Part 2

  • Go to BedRock [6] and select a subject
  • Copied and pasted all of subject's clones from their recorded visits into Phylogeny Website [7]
  • Clicked on tab labeled Tree Rendering, took screenshot using snipping tool, uploaded image to wiki
  • Clicked on tab labeled Alignment, copied and pasted sequences into wiki
  • Counted the number of clones and visits per subject
  • Counted the number of different nucleotides (S value)
  • Used a harmonic sum calculator [8], and inserted the Number of clones for the number of terms and then put S value over that number

Results Part 2

Subject 1

Alignment Subject 1
S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-12         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-14         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-15         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-13         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-16         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                ********* **** ** *  *** **    **********   ************ ***
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATA---
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-6          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACGAGAAAAAGTATA---
S1V2-11         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATA---
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-12         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-10         AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-1          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-14         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-15         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-4          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-13         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-16         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                 **  * ** **   ****  ****  ****************  *    *** ***   
S1V5-2          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          AATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-11         CATATAGGACCAGGTAGGGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-2          CATATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAA
S1V1-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-11         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-14         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-15         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-16         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-2          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                 ***** **********  ********** *    ***    * *   ******* **  
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V1-13         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-4          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAA
S1V2-6          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-11         GCACATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGCTATAAAA
S1V1-5          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAA
S1V2-5          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACGCTTTAAAACAGATAGTTATAAAA
S1V1-2          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-10         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAA
S1V1-6          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAA
S1V2-10         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-7          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-8          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-9          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-11         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAA
S1V1-3          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-9          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-7          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-1          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-1          GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-14         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-15         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-4          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-8          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-13         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-16         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-2          GCTCATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-3          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                **  ************** ** **    ** ***** * ***      **** **  ***
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-13         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          TTAAGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V2-6          TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCATTCCTCA
S1V2-11         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-5          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-5          TTAAGAGAACGCTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-12         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          TTAAGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-6          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-9          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-7          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V2-14         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-15         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-4          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-8          TTAGGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-13         TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-16         TTAAAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-2          TTAAAAGAACAACTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-3          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                ***  * ***   *    ** ***************** ** ** ***
Phylogenetic Tree Subject 1

MAP Activity 2 part 2 tree.PNG

Figure 3-Phylogenetic Tree-Activity 2, Part 2, Subject 1

Theta Subject 1
Table 2
Subject Number of Clones S Theta
1 42 90 20.8

Subject 3

Alignment Subject 3
S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ********************************** *** ************** ******
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ******** **** ****** ** ** * *************** ***** *********
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                 ****************** *******  ****** *********
Phylogenetic Tree Subject 3

MAP Activity 2, subject 3.PNG

Figure 4-Phylogenetic Tree-Activity 2, Part 2, Subject 3

Theta Subject 3
Table 3
Subject Number of Clones S Theta
3 39 42 9.88

Subject 5

Alignment Subject 5
S5V4-7          GAGGTAGTAATTAGATCCCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-1          GAGGTAGTAATTAGATCTCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-2          GAGGTAGTAATTAGATCTCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-6          GAGGTAGTAATTAGATCTCAAAATCTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V3-3          GAGGTAGTAATTAGATCCAAAAATTTCACGGACAATGCAAAAATCATAATAGTACATCTA
S5V3-4          GAGGTAGTAATTAGATCCAAAAATTTCACTGACAATGCTAAAATCATAATAGTACATCTA
S5V4-3          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-4          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V4-5          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V3-1          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V3-2          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V3-5          GAGGTAGTAATTAGATCCATAAATTTCTCAGACAATGCTAAAATCATAATAGTACATCTA
S5V5-4          GAGGTAGTAATTAGATCCACAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V5-5          GAGGTAGTAATTAGATCCACAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V5-1          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V5-3          GAGGTAGTAATTAGATCCACAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-3          GAGGTAGTTATTAGATCCAAAAATTTCTCGGACAATGTAAAAATCATAATAGTACATCTA
S5V3-6          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-6          GAGGTAGTTATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V3-8          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V3-10         GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATGATAGTACATCTA
S5V3-11         GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATGATAGTACATCTA
S5V2-10         AAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-11         GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCAAAAATCATAATAGTACATCTA
S5V2-5          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-1          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-9          GAAGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-2          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-12         GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-7          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-8          GAGGTAGTAATTAGATCCAAAAATTTCTCGGAAAATGCTAAAATCATAATAGTACATCTA
S5V1-3          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-5          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-7          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V3-7          GAGGTGGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-8          GAAGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V3-9          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-1          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAGTAGTACATCTA
S5V1-6          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-4          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V2-4          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V1-2          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
S5V5-2          GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
                 * ** ** ********   **** ** * ** ****  ********  ***********
S5V4-7          AATGAATCTGTAGAAATTAATTGTACAGGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-3          AATGAATCTGTAGAAATTAATTGTACAAGACACGGCAACAACACAAGAAGAAGTATACAT
S5V3-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAACACAAGAAGAAGTATACCT
S5V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-4          AATGAATCTGTAGAAATTAATTGCATAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V4-5          AATGAATCTGTAGAAATTAATTGCACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V5-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V5-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V5-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V5-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-3          AATGAATCTGTAGAAATTAATTGCACAAGACCCGGCAACAATACAAGAAGAAGTATACCT
S5V3-6          AATGAATCTGTAGAAATTAATTGCACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S5V3-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACCT
S5V2-5          AATGAATTTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-1          AATGAATTTGTAAAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S5V2-2          AATGAATCTGTAGAAATTAATTGTGCAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S5V2-12         AATGAATCTGTAGAAATTAATTGTGCAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S5V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAGCAACAATACAAGAAGAAGTATACAT
S5V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-5          AATGAATCTGTAGAAATTAATTGTACAAGGCCCGGCAACAATACAAGAAGAAGTATACTT
S5V2-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACCT
S5V3-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V2-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S5V5-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
                ***** * **** **********   * * * * ******* ***************  *
S5V4-7          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-1          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-2          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCG
S5V4-6          ATAGGGCCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-3          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACGTAATAGGAGATATAAGACAAGCA
S5V3-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-3          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-4          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V4-5          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-1          ATAGGACCAAACAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-2          ATAGGACCAAACAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-5          ATAGGACCAAACAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V5-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V5-5          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V5-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V5-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-6          ATAGGACCAAACAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-6          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-8          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-10         ATAGGACCAGGCGGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-11         ATAGGACCAGGCGGAGCATTTTATACAACAGGAGACATAATAGGAGGTATAAGACAAGCA
S5V2-10         GTAGGACCAGGCAGAGCATTTTATACAATAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-11         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-5          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-9          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-12         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-7          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGACATAAGACAAGCA
S5V1-8          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGACATAAGACAAGCA
S5V1-3          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGACATAAGACAAGCA
S5V1-5          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-7          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-7          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-8          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V3-9          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-1          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-6          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V2-4          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V1-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S5V5-2          ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 **** ***  * ******* ******* ******* *********  *********** 
S5V4-7          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V4-1          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V4-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V4-6          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V3-3          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGCTATAAAATTA
S5V3-4          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGCTATAAAATTA
S5V4-3          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGTTATAAAATTA
S5V4-4          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGTTATAAAATTA
S5V4-5          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGTTATAAAATTA
S5V3-1          CATTGTAACATTAGTGAAGAAGAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V3-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V3-5          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V5-4          CATTGTAACATTAGTAAAGGAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V5-5          CATTGTAACATTAGTGAAGGAAAATGGAATGAAACCTTAAAAAAGATAGCTATAAAATTA
S5V5-1          CATTGTAACATTAGTGAAGGAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V5-3          CATTGTAACATTAGTGAAGGAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V2-3          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGCTATAAAATTA
S5V3-6          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-6          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGCTATAAAATTA
S5V3-8          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGCTATAAAATTA
S5V3-10         CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V3-11         CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-10         CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-11         CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-5          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-1          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-9          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-12         CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-7          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-8          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-3          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-5          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-7          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACCTTAAAAAAGATAGTTATAAAATTA
S5V3-7          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-8          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V3-9          CATTGTAATATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-1          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-6          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-4          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V2-4          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V1-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
S5V5-2          CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
                ******** ****** *** * ************* ************* **********
S5V4-7          AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V4-1          AGAGAACAATTTGAGAATAA---AACAATAGTATTTAACTCATCCTCA
S5V4-2          AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V4-6          AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V3-3          AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V3-4          AGAAAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V4-3          AGAGAACAATTTAAGAATAA---AACAATAGTATTTAAGTCATCCTCA
S5V4-4          AGAGAACAATTTAAGAATAA---AACAATAGTATTTAAGTCATCCTCA
S5V4-5          AGAGAACAATTTAAGAATAA---AACAATAGTATTTAAGTCATCCTCA
S5V3-1          AGAGAACAATTTAGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V3-2          AGAAAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V3-5          AGAGAACAATTTAGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V5-4          AGAGAACAATTTAGGAATAA---AACAATAGTCTTTAATTCATCCTCA
S5V5-5          AGAGAACAATTTAGGAATAA---AACAATAGCATTTAATCCATCCTCA
S5V5-1          AGAGAACAATTTAGGAATAA---AACAATAGCATTTAATTCATCCTCA
S5V5-3          AGAGAACAATTTAGGAATAA---AACAATAGCATTTAATTCATCCTCA
S5V2-3          AGAGAACAATTTGTGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V3-6          AGAAAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V2-6          AGAGAACAATTTGTGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V3-8          AGAGAACAATTTGTGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V3-10         AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V3-11         AGAGAACAATTTGAGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V2-10         AGAGAACAATTTGGGAATAAAACAACAATAGTATTTAATTCATCCTCA
S5V2-11         AGAGAACAATTTGGGAATAA---AACGATAGTATTTAATTCATCCTCA
S5V2-5          AGGGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V2-1          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V2-9          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V2-2          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V2-12         AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V1-7          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCGCA
S5V1-8          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCGCA
S5V1-3          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCGCA
S5V1-5          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V2-7          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V3-7          AGAAAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V2-8          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V3-9          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V1-1          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V1-6          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V1-4          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V2-4          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATTCATCCTCA
S5V1-2          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
S5V5-2          AGAGAACAATTTGGGAATAA---AACAATAGTATTTAATCCATCCTCA
                **  ********  ******   *** ****  *****  ***** **
Phylogenetic Tree Subject 5

MAP Activity 2, subject 5.PNG

Figure 5-Phylogenetic Tree-Activity 2, Part 2, Subject 5

Theta Subject 5
Table 4
Subject Number of Clones S Theta
5 43 48 11.05

Data and Files

Phylogenetic Trees made from Phylogeny Tree Maker [9]

Phylogenetic tree for Activity 1

Phylogenetic tree of 3 clones from Subjects 1,3,5, and 7

Phylogenetic tree of subject 1 all clones, every visit

Phylogenetic tree of subject 3 all clones, every visit

Phylogenetic tree of subject 5 all clones, every visit

Research Project

Question

Can moderate and rapid progressors be categorized in the same group?

Hypothesis

Yes, moderate and rapid progressors can be categorized together, due to the fact there was no statistical significance between the two groups.

Subjects

  • Maddy and I will be performing a data clean up, we will be using 5 clones and use the first and two-year visit for each subject from the moderate and rapid progressor groups
  • In our data collection we will be removing 1,4, and 7
    • Subjects 4 and 7 will be removed from our data set because their starting CD4 count was very high in comparison to the other rapid and moderate progressors
    • Subject 1 will be removed from our data set because they only have three data points, none of which are near the two-year mark
    • We will be using five clones for each subject, for those subjects that have more than five clones we will be using a random number generator and picking five different clones from 1st and two-year visit
  • Once the sequences are gathered we will be comparing them, their S and theta values and running statistics to see if there is any meaningful difference between the rapid and the moderate progressors
  • In addition we will also be making a phylogenetic tree with all the clones from the first and two-year visits of the subjects chosen to see if there is any clustering present

Conclusion

In conclusion, sequencing and generating phylogenetic trees will allow one to find differences and similarities among sequences, enabling one to discover evolutionary relationships between the subjects and their clones. For Activity 2 Part 1 it was apparent that all clones from a subject clustered together, meaning they were more similar to themselves than the other subjects. For Activity 2 Part 2 Subject 1 has a higher theta value (20.8), leading one to believe there is greater diversity among clones and visits, while Subject 3 (9.88) and Subject 5 (11.05) had lower values.

Acknowledgements

  • I worked with Madeleine B. King and Nathan On throughout the class and compared techniques to become more efficient in the data analysis
  • I worked with Madeleine B. King twice outside of class to figure out the details in our research project
  • Madeleine B. King and I went to Kam D. Dahlquist, Ph.D. to get help figuring out the details of our research project
  • I copied and modified the protocol for Week 5 assignment
  • I asked Kam D. Dahlquist, Ph.D. about citing protocols
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Mpaniag1 (talk) 13:30, 19 February 2020 (PST)

References

Classwork

Assignments

Journals

Class Journals