Mking44 Week 5

From OpenWetWare
Jump to navigationJump to search

Assignments

Individual Journal Entries

Class Journal Entries

Purpose

The purpose of this week's assignment was to compare the diversity in and between HIV subjects by obtaining sequence data, making phylogeny trees, counting sequence differences, and doing calculations. Then by doing this, it will start the development of a new HIV evolution project.

Combined Methods and Results

Activity 1: Looking at NCBI resources and HIV sequence data

Part 1: PubMed

  • To search for the PubMed entry, I first clicked on the NCBI link on the Week 5 protocol (http://www.ncbi.nlm.nih.gov)
  • From there, I clicked on the PubMed link on the right side of the page. (https://www.ncbi.nlm.nih.gov/pubmed/)
  • Then, in the search bar I typed in the title and year Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline 1998, and it took me straight to the entry.
  • Alternatives ways to finding the article include the author & year, or subject & year
  • Some related information is available on the page, including similar papers, author information, other people who have cited the article, nucleotide sequences, protein sequences, references for the articles, and keywords that can be searched relating to the article.

Part 2: GenBank

  • To get to GenBank, I clicked on the Nucleotide link on the right of the page with the Markham paper.
  • Then, I clicked on the GenBank button for one of the clones (GenBank: AF016818.2), the FASTA format is showed by clicking the FASTA link, and the GenBank sequence is at the bottom of the page
  • The clone I chose was subject 2, visit 4, clone 2.
  • The source section under the FEATURES heading shows information about who the HIV was collected from.
  • To save the FASTA files of the sequences, you click the Send To button, File, and Create File.
  • To open the file, right click on the file, click open with, then select Notepad
  • 5 sequences are listed below:
>AF016818.2 HIV-1 subject 2, visit 4 clone 2 from USA, envelope glycoprotein V3 region (env) gene, partial cds
GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTAAATGAATCTG
TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATAAGACCAGGTAGAGCATT
TTATACAACAAGAGACATAATAAGAGATATAAGACAAGCATATTGTAACATTAGTAGAGCAGAATGGAAT
AACACTTTAAAACAGATAGTTATAAAATTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACT
CCTCA
>AF089118.1 HIV-1 isolate S3V3-6 from USA envelope glycoprotein (env) gene, partial cds
GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTGAATGAAACTG
TAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACTCTAGGACCAGGCAGAGTATA
CTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAACCTTAGTAGAGCAGATTGGAGT
AACACTTTAGAAAGAATAGCTATAAAATTAAGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAAT
CCTCA
>AF089134.1 HIV-1 isolate S3V5-3 from USA envelope glycoprotein (env) gene, partial cds
GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTGAATGAAACTG
TAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACTCTAGGACCAGGCAGAGTATA
CTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAACCTTAGTAGAGCGGGTTGGAAT
AACACTTTAGAAAGGATAGCTATAAAATTAAGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAAT
CCTCA
>AF089522.1 HIV-1 isolate S11V4-3 from USA envelope glycoprotein (env) gene, partial cds
GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTGAATGAATCTG
TAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATACATATAGGACCAGGGAGACC
ATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCACATTGTAACGTTAGTAGAGGACAATGGAAT
AAAACTTTAGAACAGGTAGTTAAAAAATTAAGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGC
AACCCATA
>AF089542.1 HIV-1 isolate S12V4-1 from USA envelope glycoprotein (env) gene, partial cds
GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTAAATGAGACTG
TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCTATAGGACCAGGCAGAGCATT
TTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCACATTGTACCCTTAGTAGAGCAAAATGGAAT
GAAACTTTAAAACAGATAGTTATAAAATTAAAAGAACAATTTAGGAATAAGACAATAGTCTTTAGTCCAT
CCTCA

Part 3: Introduction to Phylogeny.fr

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment
AF089118.1      GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
AF089134.1      GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
AF089522.1      GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
AF016818.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
AF089542.1      GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
               ** *** **********    ****** *  * ********** **** ********** 
AF089118.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGG---GTA
AF089134.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGG---GTA
AF089522.1      AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
AF016818.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
AF089542.1      AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
               *****  ****** *** ***************  ***** ** ** * ****     **
AF089118.1      ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
AF089134.1      ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
AF089522.1      CATATAGGACCAGGGAGACCATTCTATACAACAGGA---ATAAAAGGAGATATAAGACAA
AF016818.2      CATATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGATATAAGACAA
AF089542.1      CCTATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
                 * ** ******* ***  **  ********* **   **** * *********** **
AF089118.1      GCACATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAA
AF089134.1      GCACATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
AF089522.1      GCACATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAA
AF016818.2      GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
AF089542.1      GCACATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAA
               *** ****** * *********     **** * * ****** **    *** ** ****
AF089118.1      TTAAGAGAACAATTTCA---GAATAGAACAATAGTCTTTAATCAATCCTCA
AF089134.1      TTAAGAGAACAATTTCA---GAATAAAACAATAGGCTTTAATCAATCCTCA
AF089522.1      TTAAGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
AF016818.2      TTAAGAGAACACTTTGG---GAATAAAACAATAGTCTTTAATCACTCCTCA
AF089542.1      TTAAAAGAACAATTTAG---GAATAAGACAATAGTCTTTAGTCCATCCTCA
               **** ****** * *      ****  ******* *****  *   **  *
  • To save the phylo tree as a image, I used Snipping Tool app.

Mkphylotreehiv1.PNG

  • Figure 1: Phylogenetic tree of 5 different clones from different subjects

Activity 2: Looking at sources of HIV among subjects

Part 1: Looking as clustering across subjects

Mkphylogenetictreeactivity2.PNG

  • Figure 2: Phylogenetic tree of 4 subjects
  • I created a table for the 4 subjects with 3 clones using table syntax found on the Week 5 protocol.
Table 1 : Subjects 3,5,10 and 11 with Clones
Subject Clone #
3 Visit 1 Clone 3
Visit 1 Clone 4
Visit 1 Clone 5
5 Visit 1 Clone 6
Visit 1 Clone 7
Visit 1 Clone 8
11 Visit 1 Clone 1
Visit 1 Clone 2
Visit 1 Clone 3
10 Visit 1 Clone 1
Visit 1 Clone 2
Visit 1 Clone 3
  • Some of the clones from each subject cluster together. For example, in subject 3, clones 3 and 4 cluster together, and in subject 5, clones 7 and 8 cluster together. Also, subject 3 and 5 are closely related as well as 10 and 11.
  • Yes some of the subjects' clones show more diversity. Like stated before, there was divergence and lead to two clones being clustered together and one by itself.
  • No, none of the subjects clones clustered together and were in their own clades.
  • It is shown that subjects 3 and 5 had closely related clones at the first visit, and subject 10 and 11 had closely related cones at the first visit. They are each in their own clade so there were not multiple subjects that clustered together. In subject 3, clones 3 and 4 clustered together, and in subject 5, clones 7 and 8 clustered together. It is 0.50 confidence that the two paired subjects split off into their own clades, so it is hard to confirm that is true.

Part 2: Quantifying diversity within and between subjects

  • To quantify diversity within and between subjects, I chose subjects 3, 10 and 11 for analysis.
  • I downloaded all clones from one subject from Nucleotide Sequence Data found on the Week 5 Assignment, aligned them through Phylogeny.Fr with the instructions shown previously. Phylogenetic Tree and CLUSTAL alignment are shown below.
  • Then, to calculate the diversity, I will use the S statistic by counting the number of position differences between the clones for each subject and calculate θ by using the formula found on the Week 5 assignment page.
    • To calculate the number of position differences, I copy and pasted the asterisks into Word for each section and subtracted the number of characters with spaces to ones without spaces.
    • To calculate the harmonic sum, I used this calculator found on the University of Utah Department of Mathematics website which was advised by Dr. Dahlquist on the Week 5 Assignment page. For the number of terms, I used the number of clones.
Phylogenetic Trees

Mkphylotreesubject3.PNG

  • Figure 3: All visits and clones from Subject 3

Mkphylotreesubject10.PNG

  • Figure 4: All visits and clones from Subject 10

Mkphylotreesubject11.JPG

  • Figure 5: All visits and clones from Subject 11
Clustal Formats
CLUSTAL FORMAT: MUSCLE SUBJECT 3 multiple sequence alignment
S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ********************************** *** ************** ******
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ******** **** ****** ** ** * *************** ***** *********
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                 ****************** *******  ****** *********
CLUSTAL FORMAT: MUSCLE SUBJECT 10 multiple sequence alignment
S10V6-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V5-3         GAGGTAGTAATAAGATCTAAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-8         GAGGTAGTAATTAGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-15        GAGGTAGTAATTAGATCTGAAGATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAA---ATAATAGTACAGCTG
S10V4-11        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-12        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-13        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-5         GAGGTAGTAATAAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-6         GAGGTAGTAATAAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-8         GAGGTAGTAATCAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-14        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-16        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTATAGCTG
S10V6-6         GAGGTAGCAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V2-2         GAGATAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V6-8         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V2-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
                *** *** *** ****** ** * ******************   ****** ** * ***
S10V6-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAATAACAATACAAGAAGAAGTATAAAT
S10V5-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAAAATAAGT
S10V4-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-15        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-4         AATAAAGCTGTAGAAATCAATTGCACAAGACCCAACAACAATAAAAAAAGAAGAATAAGT
S10V4-11        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAGCAACAATACAAGAAGAAGTATAAAT
S10V5-9         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAGCAATACAAGAAGAAGAATAAGT
S10V5-10        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGACGAAGAATAAGT
S10V4-3         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-12        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V4-13        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V5-2         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V5-5         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAGAAGAATAAGT
S10V5-6         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAGAAGAATAAGT
S10V5-8         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V4-6         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAACACAAGAAGAAGAATAAGT
S10V4-1         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-1         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-2         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-14        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V6-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-5         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGCATACAT
S10V4-16        AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACGAGAAGAAGTATAAAT
S10V2-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-4         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATCAAT
S10V6-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATAACT
                *** ** ********** *** ************  * *** *  * *  **  **   *
S10V6-2         ATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V5-3         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATATTAGGAGATATAAGGCAAGCA
S10V4-8         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-15        ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-4         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-11        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-7         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-9         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-10        ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-3         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-12        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATGATAGGAGATATAAGGCAAGCA
S10V4-13        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-2         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGAAAGCA
S10V5-5         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-6         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-8         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-6         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-1         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCGAGCA
S10V5-1         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCGAGCA
S10V4-2         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-14        ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-7         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V4-5         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-16        ATGGGACCAGGGAGAGCATTCTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-6         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V4-9         ATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V6-3         ATGGGACCAGGGAGAGCATTGTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V6-9         ATGGGACCAGGGAGAGTATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-10        ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-1         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-2         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-8         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-4         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-1         ATGGGACCAGGGAGAGCACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAGTAATAGGAGATATAAGGCAAGCA
S10V2-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGGAATAATAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-1         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-5         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-10        ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAGTAGGAGATATAAGGCAAGCA
S10V6-4         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAAGA
S10V6-5         ATGGGACCAGGGAGAGCATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAAGA
                ***** ********** * * *** *********   *   *************  *  *
S10V6-2         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGCTGTCGACAAATTA
S10V5-3         CATCGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-8         CACTGTAGCCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA
S10V4-15        CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA
S10V5-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V4-11        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAGGTTA
S10V5-7         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-9         CATTGTAACCTTAGTTGAACGAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-10        CATTGTAACCTTAGTTGAACGAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-3         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-12        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-13        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V5-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGCTGACAAATTA
S10V5-8         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGCTGACAAATTA
S10V4-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V4-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-14        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAGAACAGGTAGTTGACAAATTA
S10V6-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAATTA
S10V4-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-16        CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA
S10V6-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAAGTAGTTGACAAATTA
S10V4-9         CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-3         CATTGTAACATTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-9         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAATTA
S10V6-10        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAATTA
S10V2-2         CATTGTAACCTTAGTAGAACAAAATGGAACGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-8         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACGAATTA
S10V2-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-6         CATTGAAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-10        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-4         TATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAAGTAGTTGACAAATTA
S10V6-5         TATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGGTGCTGACAAATTA
                 *  * * * ***** ****  ***** * ********* **** *  *    *   ***
S10V6-2         AGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V5-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-15        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-11        AGAGAACAATTTAGGAATAAAGCAATAATCGTTAATCAATCCTCA
S10V5-7         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-9         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-3         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-12        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-13        AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-5         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-6         AGGGAACAATTTAGGAATAAAACAATAATCCTTAATCAATCCTCA
S10V4-1         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-1         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-14        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-7         AGAGAACAATTTAGGAACAAAACAATAATCTTTACTCAATCCTCA
S10V4-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAAGCAATCCTCA
S10V4-16        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-6         AGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V4-9         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-9         AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V2-2         AGAGAGCAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-4         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-7         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
                 * ** *********** *** ******** ***  *********
CLUSTAL FORMAT: MUSCLE SUBJECT 11 multiple sequence alignment
S11V1-4         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAATAATGCTAAAAACATAATAGTACAGCTG
S11V3-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-7         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-1         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-10        GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-6         GAGGTAATAATTAGGTCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ************** *** ************* ***************************
S11V1-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACCAAGGATAATA
S11V3-5         AATAAATCTGTAGTAATTAATTGTACAAGACCCGATAACACTATAAAACAAAGGATAATA
S11V1-2         AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA
S11V4-2         AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V1-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-10        AATGAATCTGTAGTAATTAATTGTACGAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-8         AATGAATCTGTAGTAATTAATTGTACCAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-3         AATGGATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-4         AATGAATCTGTAGTGATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
                ***  ********* **** **** * ********  ******* **** **********
S11V1-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-5         CATATAGGACCAGGGAGACCATTCTATACAACAGAAATAAAAGGAAATATAAGACAAGCA
S11V1-2         CATATAGGACCAGGGAGACCATTCTATACGACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-9         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V4-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-10        CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-5         CATATAGGACCAGGGAGACCATTCTATACAACAAGAATAAAAGGAAATATAAGACAAGCA
S11V2-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-6         CATGTAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-9         CATATAGGACCAGGGAGACCATTCTATACAGCAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                *** *************************  **  ********** **************
S11V1-4         CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-8         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAACTTA
S11V3-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-2         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA
S11V4-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTAAGAAAATTA
S11V4-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V1-7         CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V3-10        CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-8         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA
S11V1-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-3         CATTGTAACGTTAGTAGAGGACAATGGAATAGAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
                ***************   ********* *** ******************   **  ***
S11V1-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-5         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-2         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-6         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-5         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-1         AGAGAACAATATGGACTGAACAAAACAATAGTCTTTAAGCAACCCATA
S11V4-9         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-1         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-4         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-1         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-3         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-10        AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-1         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-9         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-7         AGAGAACAATATGGACTGAATAAAACAATAGCCTTTAAGCAACCCATA
S11V1-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
                ************** *  ** ********** ****************
Theta Calculations
Figure 6: Theta formula (calculates genetic distance) Dahlquist, BIOL368: Week 5 Assignment
Table 3
Subject Number of Clones S Theta
3 39 42 9.87
10 49 73 16.3
11 32 33 8.13

Activity 3: Defining your HIV evolution project

  • To develop my HIV evolution project, I looked at the complete data from the HIV paper. (Markham et al. 1998 data table)
  • When looking at some of the graphs and the main table in Markham et. al 1998, it was observed that rapid and moderate progressors have the potential to fall into the same category.

The question

  • Should moderate progressors and rapid-progressors fall into the same group of subjects?

Hypothesis

  • Yes, they can be categorized in the same category due to the fact that they found no significant statistical difference between the rapid and moderate progressors as well as outliers are present in both groups that may have led them to be categorized into separate groups.

Data

  • To carry out the experiment, we will only look at the rapid and moderate progressors. We will exclude subject 4 (rapid)and 7(moderate) all together, because they started off with over 1,000 CD4 cells. This could have made the data adjust in a way that is not entirely concise. We will also look at only the first visit and the 2 year mark for the subjects because most of the rapids did not make it past 2 years, so the data will be more uniform between the rapid and moderates. We will also exclude subject 1(rapid) for a similar reason, because they only had three visits which may imbalance the data as well.
    • Therefore, the subjects used will be 3,10,11 and 15 for rapid, and 5,6,8,9 and 14 for moderate.
  • Looking at the clones for the first visit for the subject (Nucleotide Sequence Data) found on the Week 5 Assignment, the amount we will choose is 3 clones. We decided 3 because subject 6 has the least amount of clones (3), so we want to keep the data uniform as possible. We will also choose them randomly with a calculator so it is non-bias as possible.
  • Looking at the clones for the 2 year mark (some of the subjects have the 2 year mark at visit 4 or visit 5), the amount we will choose is 6 clones. We decided 6 because subject 8 has the least amount of clones (6), so we want to have the data uniform as possible.


Notes

  • Rapid-
    • 3 first visit:4 | 2 year mark(v4): 9
    • 10 first visit:7 | 2 year mark(v4): 16
    • 11 first visit:7 | 2 year mark(v4): 9
    • 15 first visit:12 | 2 year mark(v4): 10
  • Moderate-
    • 5 first visit:8 | 2 year mark(v4): 7
    • 6 first visit:3 | 2 year mark(v5): 9
    • 8 first visit:5 | 2 year mark(v4): 6
    • 9 first visit:5 | 2 year mark(v5): 9
    • 14 first visit:6 | 2 year mark(v5): 7

Data and Files

All data and files were phylogenetic trees made on the Phylogeny.fr website and uploaded to the wiki:

Scientific Conclusion

By first browsing through the NCBI resources and looking at the HIV sequence data, one is able to be familiar with finding their own sequences using the bioinformatics tools and therefore carryout their research project. Then, making phylogenetic trees with different combinations of sequences and analyzing them also allows for the student to know how to analyze their own data in their project. Lastly, learning how to using a statistical test such as theta to find the calculated genetic distance between different sequences allows to determine if the experiment has any significance that can add to the information for HIV-1 evolution. Therefore, using all of this gives the student experience and is prepared to begin their own project.

Acknowledgements

  1. I copied and modified the protocol from Week 5 for this assignment.
  2. I used the syntax for tables from Week 5 for this assignment.
  3. I used the Phylogeny.fr website in order to make phylogenetic trees for clones from the HIV subjects as well as obtain Clustal formats
  4. I asked my homework partner Maya some questions regarding the protocol and help with formatting as well as worked with her on our HIV evolution project outside of class.
  5. I emailed Dr. Dahlquist a question about the formatting of the data and files section.
  6. I met with Dr. Dahlquist outside of class for help on our research project.
  7. I used the harmonic sum calculator found at https://www.math.utah.edu/~carlson/teaching/calculus/harmonic.html in order to calculate theta.
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Mking44 (talk) 18:26, 16 February 2020 (PST)

References

  1. OpenWetWare. (2020). BIOL368/S20:Week 5. Retrieved Fenruary 13, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_5
  2. The Harmonic Series. (n.d.). Retrieved February 16, 2020, from https://www.math.utah.edu/~carlson/teaching/calculus/harmonic.html