Lurbinah Week 5

From OpenWetWare
Jump to navigationJump to search

Lizzy Urbina

Template:lurbinah

Assignments


Weekly Assigments

Class Journal Assigments

Purpose

Analyze the data of the Markham et al (1998) paper using online tools and getting comfortable with some data analyzers programs.

Activity 1

Part 1: PubMed

How did you search for the PubMed entry?

  • open the NCBI page
  • Selected pubmed option
  • paste the code for the paper

What other ways might you have searched?

  • Go to NCBI website
    • type the name of the paper without any filter
  • Use the link of the paper to pubmed

What other types of related information are available?

  • Nucleotides of the sequences of the genes analyzed in that paper
  • link to other scientific websites
  • Protein information
  • Other related articles

Part 2: Gen Bank

What was the accession number of the sequence you chose?

*AF089136

Which subject of the study was that HIV sequence from?

  • Subject 5, visit 5, clone 5

Which section of the record contains information about who the HIV was collected from?

  • Its is under definition, and the name of the strain is created to provided the information of the subject, visit and clone number

Part 3: Introduction to Phylogeny.fr

Alignment in Clustal Format

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


AF089141.1 GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG

AF089135.1 GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG

AF089136.1 GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG

AF089153.2 GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG

AF089541.1 GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA

               ** **************    ********* * **********  *** ********** 

AF089141.1 AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT

AF089135.1 AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT

AF089136.1 AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT

AF089153.2 AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT

AF089541.1 AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT

               *****  ****** *** ***************  **** *****  ** **   ** **

AF089141.1 CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA

AF089135.1 CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA

AF089136.1 CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA

AF089153.2 ATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCAAGCA

AF089541.1 ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA

                ********** ** * **  ***** *****    * ****** ********  *****

AF089141.1 CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA

AF089135.1 CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA

AF089136.1 CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA

AF089153.2 CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTA

AF089541.1 CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA

               ********* ******** **   ** * * * ****** **   **** **  ******

AF089141.1 AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA

AF089135.1 AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA

AF089136.1 AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA

AF089153.2 AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA

AF089541.1 AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA

               * **********  *************  ***** ** *******

Phylogenetic tree

PGTLU.02.13.2020.PNG

Activity 2

Part 1 Looking at clustering across subjects

Table 2
Subject Clone #
7 1
2
3
9 1
2
3
12 1
2
3
15 1
2
3

Phylogenetic tree. Subject 7, 9, 12, 15 visits: 1,2,3

PGTLU.S0709012015.02.13.2020.PNG

  • Do the clones from each subject cluster together?
    • Each of the different clones from each subject cluster together. There are not clones of different subjects cluster together.
  • Do some subjects' clones show more diversity than others?
    • All of them are evenly spread vertically. Although clones from subject 9, 12 and close 2 of subject 5 showed more divergence than the rest.
  • Do some of the subjects cluster together?
    • No, subjects are evenly spread.
  • Write a brief description of your tree and how you interpret the clustering pattern with respect to the similarities and potential evolutionary relationships between subjects' HIV sequences.
    • The clones of each subject are more related to each other than to other subject's clones. Additionally, diversity seems to be even in all them, however subjects 9, and 12, and clone 2 of subject 5 seemed to have more divergence than the rest of the clones.

Part 2

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment of subject 9

S9V7-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGATAATGCTAAAACCATAATAGTACAGCTG

S9V7-8 GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-9 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-10 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V7-6 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V6-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V6-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V6-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGTTG

S9V6-8 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGTTG

S9V6-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAACTG

S9V6-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAACTG

S9V4-6 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-2 GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-11 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-6 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-8 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V6-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V6-6 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-10 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-8 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V4-9 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V1-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG

S9V1-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG

S9V5-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V5-9 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V1-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-6 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V2-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V2-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V1-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V2-1 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-2 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V2-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V1-3 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG

S9V2-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-4 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-5 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V3-8 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V8-1 GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG

S9V8-4 GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG

S9V8-5 GAGGTAGTGCTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V8-2 GAGGTAGTGCTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG

S9V8-3 GAGGTAGTGGTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V8-6 GAGGTAGTGCTTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V8-7 GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG

S9V8-8 GAGGTAGTGGTTAGATCCGCCAATTTCACAAACAATGCTAAAACCATAATAGTACGGCTG

               ********* ******************** * ******************** *   **

S9V7-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAGCAACAATACAAGAAAAAGTATAAAT

S9V7-8 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-7 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-9 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT

S9V7-10 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V7-6 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-2 AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-5 AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-8 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT

S9V6-7 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACT

S9V4-6 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-11 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-7 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-6 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-8 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAACACAAGAAAAAGTATAAAT

S9V4-7 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATAAAT

S9V5-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V6-6 AAAGAACATGTAAAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-10 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-8 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V4-9 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V1-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V1-4 AAAGAACATGTAGAAATAAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V5-9 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-7 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V1-2 AAAGAACATGTAGAAATAAATTGTGCAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-6 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V2-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAGCAACAATACAAGAAAAAGTATAAAT

S9V2-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V1-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V2-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V2-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V1-3 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V2-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-4 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V3-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAGTACAAGAAAAAGTATAAAT

S9V3-8 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-1 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-4 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-5 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-2 AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-3 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAGGAAAAAGTATACAT

S9V8-6 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT

S9V8-7 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

S9V8-8 AAAGACCATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT

               ***** ****** **********  ********* *****  *** *** *******  *

S9V7-2 ATAGGACCAGGAAGAGCATTTTATGCAACAGGAGAAATAATAGGAGACATAAGACAAGCA

S9V7-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATACGACAAGCA

S9V7-3 ATAGGACCAGGAAGAGCATTTTATGCAACAGGAACAATAATAGGGGATATACGACAAGCA

S9V7-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-9 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-10 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V7-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V6-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V6-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V6-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V6-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V6-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V6-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAGGCA

S9V4-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V5-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V4-11 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V5-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGGGAAATAATAGGAGATATAAGACAAGCA

S9V5-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGGCAAGCA

S9V5-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V6-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V5-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V5-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGACAAGCA

S9V5-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAGGCA

S9V6-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V3-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCC

S9V4-10 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V4-9 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V1-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V1-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V5-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V5-9 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA

S9V3-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGCAATAATAGGAGATATAAGACAAGCA

S9V1-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V2-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V2-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V1-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V2-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V2-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V1-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V2-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V3-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA

S9V8-1 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-4 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-5 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-2 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-3 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-6 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-7 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

S9V8-8 ATAGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA

               *********** ********************   *********  * *** * ** ** 


S9V7-2 CATTGTAACATTAGTAGAACAAAATGGAATGAGACCTTAAGACAGATAGTAGAAAAATTA

S9V7-4 CATTGTAACATCAGTGGAGCAAAATGGAATGAGACCTTAAAACAGATAGCTAAAAAATTA

S9V7-1 CATTGTAACATCAGTGGAACAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V7-3 CATTGTAACATCAGTGGAACAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V7-5 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGGAAAATTA

S9V7-8 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGGAAAATTA

S9V7-7 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGGAAAATTA

S9V7-9 CATTGTAACATTAGTGGAACAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA

S9V7-10 CATTGTAACATTAGTGGAACAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA

S9V7-6 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA

S9V6-2 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGGAAAATTA

S9V6-5 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGGAAAATTA

S9V6-3 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA

S9V6-8 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAGACAGATAGCTGAAAAATTA

S9V6-4 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V6-7 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V4-6 CATTGTAATATTAGTGGAGCAAAATGGAATAACACATTAAAACAGACAGCTGAAAAATTA

S9V5-2 CATTGTAACGTTAGTGGAGCAAAATGGCATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V4-11 CATTGTAATATTAGTGGAGCAAAATGGCATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V4-2 CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAACTA

S9V5-7 CATTGTAACATTAGTGGAACAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-6 CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-8 CATTGTAACATTAGTGGAACAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V6-1 CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-4 CACTGTAACATTAGTGGAGTAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-5 CATTGTAACATTAGTGGAGTAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA

S9V4-5 CACTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA

S9V4-7 CATTGTAATATTAGTGGAGCAAAATGGAATGGCACCTTAAAACAGATAGTTGAAAAATTA

S9V5-3 CATTGTAACATTAGTGGAGCAAAATGGAATAACACCTTAAAACAGATAGTTGAAAAATTA

S9V6-6 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-3 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-1 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V4-1 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA

S9V4-4 CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTCGAAAAATTA

S9V4-3 CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGCTGAAAAATTA

S9V4-10 CATTGTAATATTAGTGGAGCAAAATGGAATGGCACCTTAAAACAGATAGTTGAAAAATTA

S9V4-8 CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V4-9 CATTGTAATATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V1-5 CATTGTAACATTAGTGGAGCAAAATGGAAGGACACCTTAAAACAGATAGTTGAAAAATTA

S9V1-4 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-1 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V5-9 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-7 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA

S9V1-2 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAGATTA

S9V3-6 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCCTAAAACAGATAGTTGAAAAATTA

S9V2-2 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V2-3 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA

S9V1-1 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V2-1 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-2 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V2-5 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA

S9V1-3 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V2-4 CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-4 CATTGTAACATTAGTGGGGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-5 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAATTA

S9V3-8 CATTGTAACATTAGTGGAGCAAAATGGAAAGACACCTTAAAACAGATAGTTGAAAAACTA

S9V8-1 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-4 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-5 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-2 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-3 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-6 CATTGTAATATTAGCAG---AAAATGGAATAACACCTTAGAACAGATAGTTAAAAAATTA

S9V8-7 CATTGTAATATTAGTAGAGGAAAATGGAATAACACCTTAAAACAGATAGTTAAAAAATTA

S9V8-8 CATTGTAATATTAGTAGAACAAAATGGAATAACACCTTAAAACAGATAGTTAAAAAATTA

               ** *****  * **  *   ******* *    **  **  ***** **    ** * **

S9V7-2 AGAGAACAATTTAGAAATAAAATAATAATCTTTAATCACTCCTCA

S9V7-4 AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-1 AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-3 AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-5 AAAGAACAATTTGGGAATAAAATAATAATCTTTAATCACTCCTCA

S9V7-8 AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-7 AGAGAACAATTTGGAAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-9 AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-10 AAAGAACAATTTGGGAATAAAACAATAATCTTTAATCACTCCTCA

S9V7-6 AGAAAACAATTTAGCAATAAAATAATAGTCTTTAATCACTCCTCA

S9V6-2 AGAGAACAATTTCAGGATAAAACAATAGTCTTTAATCACTCCTCA

S9V6-5 AGAGAACAATTTCAGAATAAAATAATAGTCTTTAGTCACTCCTCA

S9V6-3 AGAGAACAGTTTCATGATAGAACAATAATCTTTAATCACTCCTCA

S9V6-8 AGAGAACAATTTCATAATAAAACAATAATCTTTAATCACTCCTCA

S9V6-4 AGAAAACAATTTCAGGATAAAACAATAATCTTTAATCACTCCTCA

S9V6-7 AGAAAACAATTTCAGGATAAAACAATAATCTTTAATCACTCCTCA

S9V4-6 AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-2 AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V4-11 AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V4-2 AAAGAACAATTTAAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V5-7 AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-6 AAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-8 AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V6-1 AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-4 AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-5 AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V4-5 AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V4-7 AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-3 AAAGAACAATTTCAGAATAAAATAATAGTCTTTAATCACTCCTCA

S9V6-6 AGAGAACAATTTCAGAATAAAACAATAATCTTTAATCACTCCTCA

S9V3-3 AGAGAACAATTTCAGAATAGAACAGTAGTCTTTAATCACTCCTCA

S9V3-1 AAAGAACAATTTCAGAATAAAACAGTAGTCTTTAATCACTCCTCA

S9V4-1 AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V4-4 AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V4-3 AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V4-10 AGAGAACAATTTAAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V4-8 AGAGAACAATTTAAGAATAGAATAATAGTCTTTAATCACTCCTCA

S9V4-9 AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V1-5 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V1-4 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA


S9V5-1 AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V5-9 AAAGAACAATTTCAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V3-7 AGAGAACAATTTGAGAATAGAACAATAGTCTTTAATCACTCCTCA

S9V1-2 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V3-6 AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V2-2 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V2-3 AGAGAACAATTTGAGAATAAAATAATAGTCTTTAATCACTCCTCA

S9V1-1 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V2-1 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V3-2 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V2-5 AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V1-3 AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V2-4 AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA

S9V3-4 AGAGAACAATTTCATAATAAAACAGTAGTCTTTAATCACTCCTCA

S9V3-5 AGAGAACAATTTAAGAATAAAACAGTAGTCTTTAATCACTCCTCA

S9V3-8 AGAGAACAATTTAAGAATAGAACAGTAGTCTTTAATCACTCCTCA

S9V8-1 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCCCA

S9V8-4 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA

S9V8-5 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA

S9V8-2 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA

S9V8-3 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA

S9V8-6 AGAGAACAATTTCCGGGTAGAACAATAGTCTTTAATCACTCCTCA

S9V8-7 AGAGAACAATTT---AATAAAACAATAGTCTTTAATCACTCCTCA

S9V8-8 AGAGAACAATTT---AATAAAACAATAGTCTTTAATCACTCCTCA

               * * **** ***     ** ** * ** ****** ******* **

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment Subject 11

S11V1-4 GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-8 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-2 GAGGTAATAATTAGATCTGAGAATTTCTCAAATAATGCTAAAAACATAATAGTACAGCTG

S11V3-5 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-2 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-2 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-6 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-5 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-1 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-9 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-7 GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-1 GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-4 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-1 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-3 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-10 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-8 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-5 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-6 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-4 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-3 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-5 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-6 GAGGTAATAATTAGGTCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-1 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-3 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-4 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-6 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-9 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V4-7 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V1-3 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V2-2 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

S11V3-7 GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG

               ************** *** ************* ***************************


S11V1-4 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-8 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-2 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACCAAGGATAATA

S11V3-5 AATAAATCTGTAGTAATTAATTGTACAAGACCCGATAACACTATAAAACAAAGGATAATA

S11V1-2 AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA

S11V4-2 AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA

S11V4-6 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA

S11V4-5 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-1 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-9 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA

S11V1-7 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V1-1 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-4 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-1 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-3 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-10 AATGAATCTGTAGTAATTAATTGTACGAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-8 AATGAATCTGTAGTAATTAATTGTACCAGACCCGACAACACTATAAAACAAAGGATAATA

S11V1-5 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V1-6 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-4 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-3 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-5 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-6 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-1 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-3 AATGGATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-4 AATGAATCTGTAGTGATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-6 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-9 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V4-7 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V1-3 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V2-2 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

S11V3-7 AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA

               ***  ********* **** **** * ********  ******* **** **********


S11V1-4 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-8 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-2 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA

S11V3-5 CATATAGGACCAGGGAGACCATTCTATACAACAGAAATAAAAGGAAATATAAGACAAGCA

S11V1-2 CATATAGGACCAGGGAGACCATTCTATACGACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-2 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-6 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-5 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V2-1 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-9 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V1-7 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V1-1 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-4 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-1 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA

S11V4-3 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA

S11V3-10 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-8 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V1-5 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V1-6 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V2-4 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V2-3 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V2-5 CATATAGGACCAGGGAGACCATTCTATACAACAAGAATAAAAGGAAATATAAGACAAGCA

S11V2-6 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-1 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-3 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-4 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-6 CATGTAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-9 CATATAGGACCAGGGAGACCATTCTATACAGCAGGAATAAAAGGAAATATAAGACAAGCA

S11V4-7 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V1-3 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V2-2 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

S11V3-7 CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA

               *** *************************  **  ********** **************


S11V1-4 CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-8 CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAACTTA

S11V3-2 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-5 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V1-2 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-2 CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-6 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA

S11V4-5 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V2-1 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTAAGAAAATTA

S11V4-9 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA

S11V1-7 CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V1-1 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-4 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-1 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-3 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA

S11V3-10 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-8 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V1-5 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA

S11V1-6 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA

S11V2-4 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA

S11V2-3 CATTGTAACGTTAGTAGAGGACAATGGAATAGAACTTTAGAACAGGTAGTTAGAAAATTA

S11V2-5 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V2-6 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-1 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-3 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-4 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-6 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-9 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V4-7 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V1-3 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V2-2 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

S11V3-7 CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA

               ***************   ********* *** ******************   **  ***


S11V1-4 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-8 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-2 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-5 AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V1-2 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-2 AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-6 AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-5 AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-1 AGAGAACAATATGGACTGAACAAAACAATAGTCTTTAAGCAACCCATA

S11V4-9 AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA

S11V1-7 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V1-1 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-4 AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-1 AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-3 AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-10 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-8 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V1-5 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V1-6 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-4 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-3 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-5 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-6 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-1 AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-3 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-4 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-6 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-9 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V4-7 AGAGAACAATATGGACTGAATAAAACAATAGCCTTTAAGCAACCCATA

S11V1-3 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V2-2 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

S11V3-7 AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA

               ************** *  ** ********** ****************

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment Subject 12

S12V1-4         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S12V8-5         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTA
S12V4-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-8         GGGGTAGTAATTAGATCCAAGGATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-10        GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-8         GAGGTAGTAATTAGATCCAAGAATTTCGCGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-6         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-7         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
12V5-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-4         GAGGTAGTAATTAGATCCAAGGATTTCACGGATAAAGCTAAAATCATAATAGTACAGCTA
S12V5-6         GAGGTAGTAATTAGATCCAAGGATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-7         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-9         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-6         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
               * ***************     ***** **** ** ******* *************** 
S12V1-4         AACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S12V4-2         AATGAGACTGTGGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-8         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACGATACAAGAAAGAGTATACCT
S12V1-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACCATACAAGAAAAAGTATACCT
S12V2-1         AATGGGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-4         AATGAGACTGTAGAAGTTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-1         AATGAGACTGTGGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-10        AATGAGACTGTAGAAATTAATTGTACAAGACCTAACAACAATACAAGAAAAAGTATACCT
S12V8-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT 
S12V8-8         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-6         AATGAGACCGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-7         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-6         GATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-7         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-9         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-6         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
                *     * ** *** **************** ****** ********** ******* *
S12V1-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-5         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-8         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-5         ATAGGACCAGGCAGAGCATCTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-2         ATAGGACCAGGCAGAGCATCTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-10        ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-4         ATAGGACCAGGCAGAGCGTTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-8         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-6         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-7         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-5         ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-3         ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-5         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-4         ATAGGACCAGGCAGGGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-6         ATAGGACCAGGCAGGGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-7         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-9         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-6         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
               ************** ** * **** ***********************************
S12V1-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-5         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-2         CATTGTAACCTTAGTGGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-4         CATTGTAACCTTAGTGGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-8         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-5         CATTGTAACCTTAGTAGAGCAAAATGGAGTGAAACTTTAAAACAGATAGTTATAAAATTG
S12V8-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTCATAAAATTA
S12V5-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-10        CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-8         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-1         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-6         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAGACTTTAAAACAGATAGTTATAAAATTA
S12V5-7         CATTGTAACCTTAGTAGAGCAAAATGGAATGAGACTTTAAAACAGATAGTTATAAAATTA
S12V3-5         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-5         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-4         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-6         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-7         CACTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-9         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-6         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
               ** **** ******* ***********  *** ***************** ******** 
S12V1-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-2         AAAGAACAATTCAGGAATAAAACGATAGTCTTTAGTCCATCCTCA
S12V4-4         AAAGAACAATTCAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-8         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-1         AAAGAACAATTTAGAAATAAAACAATAGTCCTTAGTCCATCCTCA
S12V5-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATTCTCA
S12V1-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-10        AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-3         AAAGAACAATTTAGGAATAAAACGATAGTCTTTAGTCCATCCTCA
S12V8-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-8         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-1         AAAGAACAATTTAGGAATAAGACAATAGTCTTTAGTCCATCCTCA
S12V4-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-7         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-7         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-9         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
               *********** ** ***** ** ****** ********* ****
Table 2
Subject Number of Clones S Theta
9 64 66 13.82
11 32 34 8.2560
12 37 41 9.61

Activity 3

What is your question?

  • Are the interim visits important to record and analyze the decline of CD4 t cells in order to accurately map the progression of HIV evolution?

Make a prediction (hypothesis) about the answer to your question before you begin your analysis.

  • A steeper negative regression of CD4 T cells is directly proportional to HIV evolution. increasing mutation and diversity. We expect rapid progressor to have a greater absolute value slope.

Which subjects, visits, and clones will you use to answer your question?

  • All subjects, first and last visit.

Conclusion

Acknowledgement

  1. I contacted my homework partner, Sahil Patel and Karina Vescio over to clarify some questions I had
  2. I copied and modified wiki syntax on formatting a photo from the Media Wiki Help Page
  3. I copied and modified the procedures shown on the Week 5 Page and copy the table format
  4. Except for what is noted above, this individual journal entry was completed by me and not copied from another source. Lurbinah (talk)

References

OpenWetWare. (2020). BIOL368/S20:Week 1. Retrieved January 22, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_1

MediaWiki. (2020). Help:Images. Retrieved January 22, 2020, from https://www.mediawiki.org/wiki/Help:Images