Carolyne week 5

From OpenWetWare
Jump to navigationJump to search

Purpose

The purpose of this project is to utilize the resources provided by PubMed, GenBank, and Phylogeny.fr to determine if the HIV viruses featured in subjects that participated in the Markham et. al. (1998) study comes from a common source.

Activity 1: NCBI Resources and HIV sequence data

Methods

Part 1

  • Go to the NCBI website to search for the Markham et. al. (1998) paper in PubMed.
    • Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. doi: 10.1073/pnas.95.21.12568

Part 2

  • Did a google search to find the website for Genbank, then entered the site
  • In the footnotes of the Markham paper on PNAS, they gave accession numbers for all of the sequences studied in the paper. From that range, I chose the number
  • Found the information about the subject from the page about the sequence
  • I clicked "send to" -> "complete record" -> "file" -> "FASTA" to save the sequence as in FASTA format, then saved the record on my computer by clicking "create file".
  • I repeated steps 2 and 4 so that I could download 4-6 sequences.
  • Opened all files with text editor on my computer (TextEdit for Mac)

Part 3

  • I went to www.phylogeny.fr, then went to "phylogeny analysis" -> "one click"
  • I pasted in sequences from the text files that I saved earlier, then clicked "submit"
  • I clicked on "3. Alignment", then clicked "outputs" -> "Alignment in Clustal format"
  • I copied and pasted the aligned sequences into my assignment page, adding a space to the beginning of the lines so that the sequence alignment was kept
  • Then, I clicked on "6. Tree Rendering," saved the tree as a .png file, uploaded the image, and displayed it on my assignment page

Results

Part 1: Pubmed

  1. I searched for the PubMed entry by going to the NCBI website and using the PubMed ID for the Markham et. al. (1998) article to search for the article.
  2. There are several other ways that I could have found the article. I could have gone directly to the PubMed website rather than going through the NCBI website. Then at the PubMed website, I could have searched for the article using the title of the article.
  3. The entry on PubMed includes links to GenBank, where the sequences reported in the paper have been deposited. It also includes contact information and the abbreviations featured in the paper. It also includes citation tools and links to similar papers or related topics.

Part 2: GenBank

  1. The accession number is AF016761.1.
  2. The HIV sequence comes from Subject 1 during their first visit. The sequence is of clone 2.
  3. The section of the record that contains information about the source of the HIV sequence is the "source" section under the Features category. In this case, information about the source was also featured in the Definition category.

Part 3: Phylogeny.fr

  • Sequence Alignment Results
    1. CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


AF016763.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF016764.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF016761.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF016765.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF016762.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF016766.1      GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ************************************************************
AF016763.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016764.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016761.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016765.1      AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016762.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016766.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ******************** ***************************************
AF016763.1      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
AF016764.1      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
AF016761.1      ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
AF016765.1      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
AF016762.1      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
AF016766.1      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
                *** ************************************** ************  ***
AF016763.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAATTA
AF016764.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
AF016761.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF016765.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAATTA
AF016762.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF016766.1      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                *********************************** **** *** *******  ******
AF016763.1      AGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
AF016764.1      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016761.1      AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016765.1      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016762.1      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016766.1      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                ************ * ** *********************** ***
  • Image of Phylogenetic tree produced after sequence alignment
    1. Markham S1V1C2-7 Phylo Tree.png

Activity 2: HIV across subjects

Methods

Part 1

  • I downloaded the files Visit_1_Subjects_1_thru_9_HIV.txt and Visit_1_Subjects_10_thru_15_HIV.txt
  • I selected subject 6, 7, 11, and 12 and chose to look at clones 1-3 from visit one for each subject
  • I used the resources at www.phylogeny.fr to create a multiple sequence alignment and phylogenetic tree comparing clones 1-3 from visit one from subjects 6,7, 11, and 12
  • I copied and pasted my sequence alignment results into my wiki journal, saved my phylogenetic tree as a .png file, and uploaded my phylogenetic tree
  • I copied the syntax from table 2 from the Week 5 assignment page to create my table and recorded the subject and clone number I chose in the table

Part 2

  • I copied the syntax used to create table 3 in the week 5 assignment page so that I could create table 2 on my page.
  • I downloaded all of the clone sequences for subjects 6, 11, and 12 from the Nucleotide Sequence Data page
  • I used www.phylogeny.fr to align all of the sequences for each subject and create phylogenetic trees. The images of the trees were uploaded to my assignment page.
  • I calculated S by using the "Find" feature in the Google Chrome browser to find the number of * that were on the aligned sequence page for each subject. I verified this number by copying and pasting all of the * into a word document, and counting how many there were. This process was done three times to get an S value for each subject
  • The data was entered into table 2 on my assignment page
  • For each subject, I used the site the harmonic series. The S value was entered into the "number of terms" box, and then I clicked "compute." This gave me the partial sums.
  • For each subject, theta was found by dividing the S value by the partial sum

Results

Part 1: Clustering

  • Mutiple Sequene Alignment
    1. CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S11V1-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-1         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S12V1-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S7V1-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V1-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-2          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ** **********    ***  * *  * *** **** * ********* ** *  
S11V1-2         AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA
S11V1-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S12V1-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
S12V1-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACCATACAAGAAAAAGT---ATA
S12V1-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGT---ATA
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGT---ATA
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGT---ATA
S7V1-3          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGT---ATA
S7V1-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGT---ATA
S7V1-2          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
                ****   ****** *** * ****** ****** *****  **  *   ** *    ***
S11V1-2         CATATAGGACCAGGGAGACCATTCTATACGACAGG---AATAAAAGGAAATATAAGACAA
S11V1-1         CATATAGGACCAGGGAGACCATTCTATACAACAGG---AATAAAAGGAAATATAAGACAA
S11V1-3         CATATAGGACCAGGGAGACCATTCTATACAACAGG---AATAAAAGGAAATATAAGACAA
S12V1-3         CCTATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S12V1-2         CCTATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S12V1-1         CCTATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S6V1-1          CATATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAA
S6V1-3          CATATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAA
S6V1-2          CATATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAA
S7V1-3          TCTATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAA
S7V1-1          CCTATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGGAATATAAGACAA
S7V1-2          CTTATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAA
                 ************ *** **** *** * *****   ***** ***  ***********
S11V1-2         GCACATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAA
S11V1-1         GCACATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAA
S11V1-3         GCACATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAA
S12V1-3         GCACATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAA
S12V1-2         GCACATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAA
S12V1-1         GCACATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAA
S6V1-1          GCACATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAA
S6V1-3          GCACATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAA
S6V1-2          GCACATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAA
S7V1-3          GCACATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAA
S7V1-1          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAA
S7V1-2          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAA
                ************ *** ***** * ********     **** **  * *** ** ****
S11V1-2         TTAAGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-1         TTAAGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-3         TTAAGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S12V1-3         TTAAAAGAACAATTTAG---GAATAAAACAATAGTCTTTAGTCCATTCTCA
S12V1-2         TTAAAAGAACAATTTAG---GAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-1         TTAAAAGAACAATTTAG---GAATAAAACAATAGTCTTTAGTCCATCCTCA
S6V1-1          TTAAGAGAACAATTTAA---GAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          TTAAGAGAAGTATTTAA---GAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          TTAAGAGAACAATTTAA---GAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-3          TTAAGAAAACAATTTGA---GAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-1          TTAAGAAAACAATTTGA---GAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-2          TTAAGAAAACAATTTGA---GAATAAAACAATAGTCTTTAATCAATCATCA
                **** * **  ** *     ********************  * *     *
  • Distance tree
    1. Markham SMultiV1C1-3.png
  • Table of Subject and Clone numbers
Table 1
Subject Clone #
Subject 6 1
2
3
Subject 7 1
2
3
Subject 11 1
2
3
Subject 12 1
2
3


  • Questions
    1. It appears that the clones taken from each subject cluster together with other clones taken from that subject. For example, all of the clones from Subject 6 are clustered together.
    2. It appears that clones from Subjects 6 and 7 show more diversity. In each subject, there was a clone that was not as closely related to two other clones in the cluster.
    3. The subjects that have clones that appear to be more closely related are Subjects 6 and 12. Based on the sequence data, it appears that their clones share a common ancestor.
    4. The phylogenetic tree shows results from analyzing DNA sequences of HIV clones from subjects in the Markham et. al (1998) paper. Overall, each clone from each subject clusters most closely together with other clones from that same subject. Interestingly, clones from subjects 6 and 12 seem to be more closely related to each other than to clones from subjects 7 and 11. This shows that clones from subjects 6 and 12 may share a similar evolutionary history. In addition, one clone in subjects 6 and 7 branched off early compared to the other two clones in each subject. This shows that even within a subject, the S6V1-3 and S7V1-2 clones are less evolved compared to the other clones from that subject.

Part 2: Quantifying Diversity

Summary Table
  • Table 2
Table 2
Subject Number of Clones S Theta
6 54 75 16.39
11 32 31 7.63
12 37 42 10.00
Sequence Alignments and Phylogenetic Trees
Sequence Alignment and Tree for Subject 6
CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S6V9-9          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V9-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-2          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-4          GAAGAAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V9-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAAACATAATAGTGCATCTG
S6V5-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-6          GAAATAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-9          GATATAGTAATTAGATCCGCCAGTCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-4          GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-12         GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-5          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-1          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-6          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCCAAAATCATAATAGTGCATCTG
S6V4-10         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-3          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-5          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-7          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-8          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-11         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-2          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-7          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V3-7          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAGAATCATAATAGTGCATCTG
S6V3-1          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCGTAATAGTGCATCTG
S6V3-3          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-8          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-6          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-6          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-4          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-5          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-6          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-9          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTACATCTG
S6V7-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
                **   ************** ** ** * *  ***** * * ** * ******* **** *
S6V9-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-2          AATGAATCTGTAGAAATGAATTGTACAAGGCCCAACAACAATACAAGAAGAGGTATACAT
S6V7-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-8          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-6          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V4-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-12         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-10         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACGACAATACAAGAAGAGGTATACAT
S6V4-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-7          GATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-11         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-9          AATGAACTTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-5          AATGAACATGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAGCAATACAAGAAAAGGTATACAT
S6V7-7          AATAAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-6          AATGAATCTGTAGAAATGAATTGTACAAGACCTAACAACAATACAAGAAAAGGTATACAT
S6V7-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
                 ** **  ***** *** *********** ** ***  *********** **********
S6V9-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V9-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGTATAATAGGAAATATAAGACAAGCA
S6V7-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCC
S6V5-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V7-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V5-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V9-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V9-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-12         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V9-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V4-1          ATAGGACCTGGCAGAGCATTTTATGCAACAGGAGAAGTAATAGGAAATATAAGACAAGCA
S6V4-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATGATAGGAAATATAAGACAAGCA
S6V4-10         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-11         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGACAAGCA
S6V9-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V5-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACTAGCA
S6V3-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGACATAAGACAAGCA
S6V3-8          ATAGGACCAGGCAGAGCATTTTATGCAGCAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V3-9          ATAGGGCCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V7-7          ATAGGACCAGGCAGAGCATTTTATACAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-5          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-9          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGAAAATATAAGACAAGCA
S6V7-3          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
                ***** ** *************** ** ** **    * **** * * ******* *** 
S6V9-9          CATTGTAACCTTAGTAGAACACAATGGAATGACCATTTAAAAAGGGTAGCTATAAAATTA
S6V9-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-8          CATTGTAACCTTAGTAGAGCACAGTGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-4          CATTGCAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-4          CATTGTAACCTTAGTAGAGAACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-8          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V5-8          CATTGTAACCTTCGTAGAGCACAATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V9-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-4          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTCTAAAAAGGGTAGCTATAAAATTA
S6V4-4          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-12         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-10         CATTGTAACCTTAGTAGAGCACAATTGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-11         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-9          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-7          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-3          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACCATTTAAAAAGGAAAGCTATAAAATTA
S6V5-5          CATTGTAACCTTAGTAGAGAACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V2-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACATTTTAAAAAGGATAGCTATAAAATTA
S6V3-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-6          CATTGTAACCTTAGTAGAGGACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V9-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-4          CATTGTAACCTTAGTAGAGCACGATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-5          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-6          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-9          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
                ***** ****** *****  **  * *****    * ********  *************
S6V9-9          AGAGAACAATTTAAAGCTAATACAATAGTCTTTAATCAATCCTCA
S6V9-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCTATCCTCA
S6V7-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTATTCAATCCTCA
S6V7-2          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-1          GGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-6          AGAGAACAATTTAAGACTAAAACAATAGTCTTTAATCAATCCTCA
S6V9-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-4          AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCAATCCTCA
S6V4-12         AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCATTCCTCA
S6V9-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-10         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-3          AGAGAACAATCTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-5          AGAGAACAATTTAAGAATAAAACAGTAGTCTTTAATCAATCCTCA
S6V4-7          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-8          AGAGAACAATTTAGGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-11         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCATTCCTCA
S6V4-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-7          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-3          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-3          AGAGAACAATTTAAGATAAAAACAATAGTCTTTAATCAATCCTCA
S6V2-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-7          AGAGAACAATTTAAGAATAAAGCAATAGTCTTTAATCAATCCTCA
S6V3-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-8          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCTATCCTCA
S6V3-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTCCTCAATCCTCA
S6V7-5          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-6          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-9          AGAGAACAATTTAAAAATAAAACAATAGTCTTTATTCAATCCTCA
S6V7-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTACTCAATCCTCA
                 *****  ** **      *  ** *** ****   *  ******

Subject 6 phylo tree all visits.png

Sequnce Alignment and Tree for Subject 11
CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S11V1-4         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAATAATGCTAAAAACATAATAGTACAGCTG
S11V3-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-7         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-1         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-10        GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-6         GAGGTAATAATTAGGTCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ************** *** ************* ***************************
S11V1-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACCAAGGATAATA
S11V3-5         AATAAATCTGTAGTAATTAATTGTACAAGACCCGATAACACTATAAAACAAAGGATAATA
S11V1-2         AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA
S11V4-2         AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V1-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-10        AATGAATCTGTAGTAATTAATTGTACGAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-8         AATGAATCTGTAGTAATTAATTGTACCAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-3         AATGGATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-4         AATGAATCTGTAGTGATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
                ***  ********* **** **** * ********  ******* **** **********
S11V1-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-5         CATATAGGACCAGGGAGACCATTCTATACAACAGAAATAAAAGGAAATATAAGACAAGCA
S11V1-2         CATATAGGACCAGGGAGACCATTCTATACGACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-9         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V4-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-10        CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-5         CATATAGGACCAGGGAGACCATTCTATACAACAAGAATAAAAGGAAATATAAGACAAGCA
S11V2-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-6         CATGTAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-9         CATATAGGACCAGGGAGACCATTCTATACAGCAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                *** *************************  **  ********** **************
S11V1-4         CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-8         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAACTTA
S11V3-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-2         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA
S11V4-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTAAGAAAATTA
S11V4-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V1-7         CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V3-10        CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-8         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA
S11V1-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-3         CATTGTAACGTTAGTAGAGGACAATGGAATAGAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
                ***************   ********* *** ******************   **  ***
S11V1-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-5         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-2         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-6         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-5         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-1         AGAGAACAATATGGACTGAACAAAACAATAGTCTTTAAGCAACCCATA
S11V4-9         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-1         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-4         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-1         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-3         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-10        AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-1         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-9         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-7         AGAGAACAATATGGACTGAATAAAACAATAGCCTTTAAGCAACCCATA
S11V1-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
                ************** *  ** ********** ****************

Subject 11 Phylogenetic tree.png

Sequnce Alignment and Tree for Subject 12
CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S12V1-4         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S12V8-5         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTA
S12V4-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-8         GGGGTAGTAATTAGATCCAAGGATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-10        GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-8         GAGGTAGTAATTAGATCCAAGAATTTCGCGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-6         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-7         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V2-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V3-4         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-2         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V4-5         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-4         GAGGTAGTAATTAGATCCAAGGATTTCACGGATAAAGCTAAAATCATAATAGTACAGCTA
S12V5-6         GAGGTAGTAATTAGATCCAAGGATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-7         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V5-9         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V8-6         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
                * ***************     ***** **** ** ******* *************** 
S12V1-4         AACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S12V4-2         AATGAGACTGTGGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-8         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACGATACAAGAAAGAGTATACCT
S12V1-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACCATACAAGAAAAAGTATACCT
S12V2-1         AATGGGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-4         AATGAGACTGTAGAAGTTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-1         AATGAGACTGTGGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-10        AATGAGACTGTAGAAATTAATTGTACAAGACCTAACAACAATACAAGAAAAAGTATACCT
S12V8-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-8         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-6         AATGAGACCGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-7         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V2-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V3-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-2         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V4-5         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-4         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-6         GATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-7         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V5-9         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V8-6         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
                 *     * ** *** **************** ****** ********** ******* *
S12V1-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-5         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-8         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-5         ATAGGACCAGGCAGAGCATCTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-2         ATAGGACCAGGCAGAGCATCTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-10        ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-4         ATAGGACCAGGCAGAGCGTTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-8         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-6         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-7         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-5         ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-3         ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V2-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V3-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-2         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V4-5         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-4         ATAGGACCAGGCAGGGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-6         ATAGGACCAGGCAGGGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-7         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V5-9         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V8-6         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
                ************** ** * **** ***********************************
S12V1-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-5         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-2         CATTGTAACCTTAGTGGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-4         CATTGTAACCTTAGTGGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-8         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-5         CATTGTAACCTTAGTAGAGCAAAATGGAGTGAAACTTTAAAACAGATAGTTATAAAATTG
S12V8-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTCATAAAATTA
S12V5-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-10        CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-8         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-1         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-6         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAGACTTTAAAACAGATAGTTATAAAATTA
S12V5-7         CATTGTAACCTTAGTAGAGCAAAATGGAATGAGACTTTAAAACAGATAGTTATAAAATTA
S12V3-5         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V2-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V3-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-2         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V4-5         CATTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-4         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-6         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-7         CACTGTACCCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V5-9         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V8-6         CATTGTACCCTTAGTAGAGCAAAATGGGATGAAACTTTAAAACAGATAGTTATAAAATTA
                ** **** ******* ***********  *** ***************** ******** 
S12V1-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-2         AAAGAACAATTCAGGAATAAAACGATAGTCTTTAGTCCATCCTCA
S12V4-4         AAAGAACAATTCAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-8         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-1         AAAGAACAATTTAGAAATAAAACAATAGTCCTTAGTCCATCCTCA
S12V5-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATTCTCA
S12V1-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-10        AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-3         AAAGAACAATTTAGGAATAAAACGATAGTCTTTAGTCCATCCTCA
S12V8-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-8         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-1         AAAGAACAATTTAGGAATAAGACAATAGTCTTTAGTCCATCCTCA
S12V4-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-7         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V2-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V3-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-2         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V4-5         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-7         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V5-9         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V8-6         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
                *********** ** ***** ** ****** ********* ****

Subject 12 phylo tree all visits .png

Activity 3: Defining HIV Evolution Research Project

  • Question: How does the location and identity of nucleotide differences observed in HIV clones in subjects with a similar slope of divergence affect viral virulence?
  • Hypothesis: Subjects within each category will have similar nucleotide changes in similar locations when compared to subjects from other categories (ex. rapid progressors will have similar changes in sequences compared to moderate or nonprogressors, etc.)
  • Subjects, Visits, Clones: For this project, we plan to look at subjects 2, 3, 5, 11, 13, and 14 because all of these subjects had slopes of divergence that were relatively close together. In addition, there are two representatives from each of the progressor groups defined in the study. Since these subjects were all present at visit one and visit 4, these only clones from these two visits will be examined so that the time between visits is the same for all subjects. Between the two visits for these subjects, there are 86 sequences total. To reduce this number to a more manageable 50 sequences, it is possible that only clones 1-4 from each subject for each visit will be examined so that only 48 sequences are analyzed total. In addition to making the number of sequences more manageable to analyze, eliminating extra clones will put the subjects on an equal playing field since subjects 3 and 13 only had 4 clones at visit one.

Data Files

[Sequence for AF016761.1] [Sequences for clones from subjects 1-9 at visit 1] [Sequences for clones from subjects 10-15 at visit 1] [Sequences from subject 6] [sequences from subject 12] [sequences from subject 7] [[1]]

Scientific Conclusion

The purpose of this task was to utilize tools for sequencing DNA and creating phylogenetic trees to determine if the clones from each subject at visit 1 came from a similar source. Based on the phylogenetic tree that compared 3 clones from subjects 6, 7, 11, and 12 revealed that the clones obtained from each subject were more closely related to each other than to clones from other subjects. In addition, aligning all of the sequences obtained from subjects 6, 11, and 12 revealed that subject 6 had the greatest value for theta (followed by subject 12 and subject 11). This shows that there is greater genetic divergence in clones from subject 6 than there is in clones from subjects 11 and 12. These results and techniques help to form the basis for further study of the Markham et. al. (1998) data to understand how different factors may play a role in HIV evolution observed in the study.

Acknowledgements

I worked with Nathan On to create the research question, make a prediction, and decide the subjects, visits, and clones to use for the project. I copied and modified the protocol and copied the syntax for all tables from the Week 5 page. I also created by phylogenetic trees and obtained the sequence alignments using Phylogeny. fr. I obtained all of the sequences for subjects 6, 11, and 12 from the Bedrock HIV Nucleotide Sequence Data page. I used the site the harmonic series to help me calculate theta for each subject. Except for what is noted above, this individual journal entry was completed by me and not copied from another source. Carolyne (talk) 23:39, 19 February 2020 (PST)

References

  1. OpenWetWare. (2020). BIOL368/S20:Week 5. Retrieved February 13, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_5.
  2. The harmonic series. (n.d.). Retrieved February 13, 2020, from https://www.math.utah.edu/~carlson/teaching/calculus/harmonic.html
  3. Markham, R. B., Wang, W. C., Weisstein, A. E., Wang, Z., Munoz, A., Templeton, A., ... & Yu, X. F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proceedings of the National Academy of Sciences, 95(21), 12568-12573. doi: 10.1073/pnas.95.21.12568
  4. HIV-1 subject 1 visit 1 clone 2 from USA, envelope glycoprotein V3 reg - Nucleotide - NCBI. (n.d.). Retrieved February 13, 2020, from https://www.ncbi.nlm.nih.gov/nuccore/AF016761.1
  5. Dereeper A., Guignon V., Blanc G., Audic S., Buffet S., Chevenet F., Dufayard J.F., Guindon S., Lefort V., Lescot M., Claverie J.M., Gascuel O. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008 Jul 1;36(Web Server issue):W465-9. Epub 2008 Apr 19.

User Page and Template Links

Individual Journal Pages

  1. Carolyne week 2
  2. Carolyne week 3
  3. Carolyne week 4
  4. Carolyne week 5
  5. Carolyne week 6
  6. Carolyne week 8
  7. Carolyne week 9
  8. Carolyne week 10
  9. Carolyne week 13
  10. Carolyne week 14

Weekly Assignments

  1. BIOL368/S20:Week 1
  2. BIOL368/S20:Week 2
  3. BIOL368/S20:Week 3
  4. BIOL368/S20:Week 4
  5. BIOL368/S20:Week 5
  6. BIOL368/S20:Week 6
  7. BIOL368/S20:Week 8
  8. BIOL368/S20:Week 9
  9. BIOL368/S20:Week 10
  10. BIOL368/S20:Week 13
  11. BIOL368/S20:Week 14

Class Journal Pages

  1. BIOL368/S20:Class Journal Week 1
  2. BIOL368/S20:Class Journal Week 2
  3. BIOL368/S20:Class Journal Week 3
  4. BIOL368/S20:Class Journal Week 4
  5. BIOL368/S20:Class Journal Week 5
  6. BIOL368/S20:Class Journal Week 6
  7. BIOL368/S20:Class Journal Week 8
  8. BIOL368/S20:Class Journal Week 9
  9. BIOL368/S20:Class Journal Week 10
  10. BIOL368/S20:Class Journal Week 13
  11. BIOL368/S20:Class Journal Week 14