Search results

From OpenWetWare
Jump to navigationJump to search
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)
  • . . 299 300 . . . . 50 49 . . . . 176 175 . . . . 302 301 . . . . 51 52 . . . . 177 178 . . . . 303 304 . . . . 54 53 . . . . 180 179 . . . . 306 305 ...
    6 KB (521 words) - 14:36, 27 July 2006
  • identifiability of power-law biochemical system models. J. Biotechnol, 2010. 149:132-140, 2010. S. K. Poovathingal, J. Gruber, B. Halliwell, and R. Gunawan. Stochastic...
    11 KB (1,617 words) - 15:38, 5 July 2011
  • A., “Cell Motility: Making Connections Count”, Nature 383: 390-391 (1996). 16. Grodzinsky, A.J., R.D. Kamm, and D.A. Lauffenburger, "Quantitative Aspects...
    50 KB (8 words) - 21:01, 13 December 2005
  • Introduction to Programming using Python for Biologists at the Pasteur Institute [16] Python HOWTOs [17] Regular Expression HOWTO [18] Python Programming Tutorial...
    27 KB (1,648 words) - 03:07, 5 August 2008
  • C c5.0.16 and 17: bottom lid latches (16) and "splits" (17) oligo 80la c5.0.16.1 TAATTTCCTGACGAGAAACACTTTTTTTAGAGACGACCATAC oligo 30la c5.0.16.2 GGATT...
    35 KB (134 words) - 20:28, 12 September 2006
  • AGTAACAA CCCGTCGG TTAACCAA cho 15 : TAGGAACG ATATTCAA CCGTTCTA AATGCAAT cho 16 : GCCTGAGT GATACATT TCGCAAAT AAGTACGG cho 17 : TGTCTGGA CCATAAAT CAAAAATC...
    18 KB (27 words) - 03:55, 23 October 2015
  • 88-111 5 $6.50 $32.50 11/16/2007 Kathy x B500C 11/16/2007 Fisher cyrotube holder 15-350-21 1 $50.95 $50.95 11/14/2007 Jihye x B500C 11/16/2007 Fisher cyrotube...
    38 KB (119 words) - 03:29, 21 September 2008
  • Dextrose Anhydrous (glucose) - 1.0g (0.0056 mol) CH2OH(CHOH)4CHO MW 180.16 CAS 50-99-7 Thiamine (0.1% stock) - 0.25ml (xxx mol) MW CAS Magnesium Sulfate...
    10 KB (1,650 words) - 16:37, 9 July 2009
  • 0, 000 10, 0, 000 11, 0, 000 12, 0, 000 13, 0, 000 14, 0, 000 15, 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000...
    17 KB (2,300 words) - 18:43, 29 October 2007
  • 0, 000 10, 0, 000 11, 0, 000 12, 0, 000 13, 0, 000 14, 0, 000 15, 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000...
    17 KB (2,300 words) - 06:16, 18 August 2008
  • summary(ImFa) Min. 1st Qu. Median Mean 3rd Qu. Max. NA's 0.064 1.000 1.578 2.132 2.762 16.690 6.000 > SomeOA = ifelse(Subscription.Model == "Sub", 0, 1) > table(SomeOA)...
    7 KB (0 words) - 02:05, 27 September 2017
  • Correlation Spectroscopy”, Optics Express, 2008, 16, 14609-16 DOI: http://pubs.acs.org/10.1364/OE.16.014609 . PMID: 18794997 PMCID:PMC 2832597 106. Iyer...
    46 KB (6,833 words) - 19:08, 18 December 2019
  • 0, 000 10, 0, 000 11, 0, 000 12, 0, 000 13, 0, 000 14, 0, 000 15, 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000...
    17 KB (2,300 words) - 17:45, 24 August 2009
  • 0, 000 10, 0, 000 11, 0, 000 12, 0, 000 13, 0, 000 14, 0, 000 15, 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0, 000...
    17 KB (2,300 words) - 01:58, 7 August 2010
  • 67 77.65 16.73 88.91 mutL DNA mismatch repair protein bactF10744 124 81.18 9.40 22.51 hydrolase carbon-nitrogen family bactF10745 89 98.82 65.16 65.53 nadE...
    37 KB (6,806 words) - 22:15, 17 August 2017
  • 49⁰12'/ E 16⁰37' *Br-0 CS28094 Tschechien, Brünn N 49⁰12'/ E 16⁰37' *Bs-2 CS28097 Schweiz, Basel N 47⁰50'/ E 7⁰50' Bs-5 463AV Schweiz, Basel N 47⁰50'/ E 7⁰50'...
    39 KB (10 words) - 14:02, 15 April 2012
  • Consumption,” in Roy Porter and John Brewer, Consumption and the World of Goods 16) Mintz, Sidney, Tasting Food, Tasting Freedom: Excursions into Eating, Culture...
    19 KB (2,847 words) - 19:52, 19 November 2007
  • of Drug Loading and Intermolecular Interactions. Molecular Pharmaceutics. 16(12):5054-5067. http://dx.doi.org/10.1021/acs.molpharmaceut.9b01025 287. Elkhabaz...
    84 KB (7 words) - 19:53, 20 August 2020
  • Tumor Suppressor Genes in trans by Disrupting ceRNA Crosstalk. Nature Genetics 50 (2018) 783-789 Su J^, Huang YH^, Cui X, Zhang X, Lei Y, Wang X, Lin X, Chen...
    55 KB (7,535 words) - 21:26, 13 July 2020
  • 47.6875 Med 14-Med 0.757 132.99 84.69 111.8758256 High 15-High 0.715 219.16 170.86 238.965035 Superpos control from David 16-Superpos 1.08 3659.33 3611...
    8 KB (958 words) - 22:27, 15 June 2009
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)