Non: Week 5

From OpenWetWare
Jump to navigationJump to search

User:Non

Template:Non

Course Work
Assignments Journal Pages Shared Class Journal Pages
BIOL368/S20:Week 1 BIOL368/S20:Class Journal Week 1
BIOL368/S20:Week 2 Non: Week 2 BIOL368/S20:Class Journal Week 2
BIOL368/S20:Week 3 Non: Week 3 BIOL368/S20:Class Journal Week 3
BIOL368/S20:Week 4 Non: Week 4 BIOL368/S20:Class Journal Week 4
BIOL368/S20:Week 5 Non: Week 5 BIOL368/S20:Class Journal Week 5
BIOL368/S20:Week 6 Non: Week 6 BIOL368/S20:Class Journal Week 6
BIOL368/S20:Week 8 Non: Week 8 BIOL368/S20:Class Journal Week 8
BIOL368/S20:Week 9 Non: Week 9 BIOL368/S20:Class Journal Week 9
BIOL368/S20:Week 10 Non: Week 10 BIOL368/S20:Class Journal Week 10
BIOL368/S20:Week 13 Non: Week 13 BIOL368/S20:Class Journal Week 13
BIOL368/S20:Week 14 Non: Week 14 BIOL368/S20:Class Journal Week 14

Purpose

The purpose of this week's lab is to explore several bioinformatic tools using the Markham et. al data that can be used to formulate a research question.

Combined Methods/Results

Activity 1

Part 1

Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. doi: 10.1073/pnas.95.21.12568 (PubMed ID: 9770526)

  • I went to Pubmed and searched for the Markham article using a variety of keywords.
    • Some keywords that worked:
      • "Markham RB" - first author's name, result #23
      • "Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline." - copy-pasted full title of article
      • "9770526" - PubMed ID
    • Some related information with the article include:
      • MedGen references for definitions
      • List of published nucleotide sequences (666 results)
      • List of references cited by the article (49 results)
      • Taxonomy data from GenBank for HIV-1
      • List of published protein sequences (656 results)
      • Full text article on PubMedCentral
      • Articles that cited the main article (44 results)

Part 2

  • Next, I went to GenBank page for all the nucleotide sequences from the article. I clicked on result #13.
    • Ascension number - AF089134
    • Subject #3
    • The subject is found after HIV-1 isolate; the number following S determines the subject number; the number after V denoting the visit number; the number after the dash signifying the clone number.
      • >AF089134.1 HIV-1 isolate S3V5-3 from USA envelope glycoprotein (env) gene, partial cds

GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTGAATGAAACTG TAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACTCTAGGACCAGGCAGAGTATA CTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAACCTTAGTAGAGCGGGTTGGAAT AACACTTTAGAAAGGATAGCTATAAAATTAAGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAAT CCTCA

>AF016818.2 HIV-1 subject 2, visit 4 clone 2 from USA, envelope glycoprotein V3 region (env) gene, partial cds GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTAAATGAATCTG TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATAAGACCAGGTAGAGCATT TTATACAACAAGAGACATAATAAGAGATATAAGACAAGCATATTGTAACATTAGTAGAGCAGAATGGAAT AACACTTTAAAACAGATAGTTATAAAATTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACT CCTCA

>AF089541.1 HIV-1 isolate S12V3-5 from USA envelope glycoprotein (env) gene, partial cds GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTAAATGAGACTG TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCTATAGGACCAGGCAGGGCATT TTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCACATTGTAACCTTAGTAGAGCAAAATGGAAT GAAACTTTAAAACAGATAGTTATAAAATTAAAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCAT


CCTCA

>AF089198.1 HIV-1 isolate S5V1-4 from USA envelope glycoprotein (env) gene, partial cds GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTAAATGAATCTG TAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACATATAGGACCAGGCAGAGCATT TTATACAACAGGAGACATAATAGGAGATATAAGACAAGCACATTGTAACATTAGTGAAGAAAAATGGAAT GAAACTTTAAAAAAGATAGTTATAAAATTAAGAGAACAATTTGGGAATAAAACAATAGTATTTAATTCAT CCTCA

>AF089665.1 HIV-1 isolate S14V9-9 from USA envelope glycoprotein (env) gene, partial cds GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTGAATGAATCTG TAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATAGGACCAGGGAGAGCATT TTATGCAACAGGAAAGATAATAGGAGATATAAGACAAGCACATTGTAACCTTAGTAGAACAAGATGGAAT GACACTTTAAAACAGATAGTTTACAAATTAAGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATC AATCCTCA

>AF089265.1 HIV-1 isolate S6V5-1 from USA envelope glycoprotein (env) gene, partial cds GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTGAATGAATCTG TAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACATATAGGACCAGGCAGAGCATT TTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCACATTGTAACCTTAGTAGAGCACAATGGAAT GACACTTTAAAAAGGGTAGCTATAAAATTAAGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAAT CCTCA

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment
AF089134.1      GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
AF089265.1      GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
AF016818.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
AF089665.1      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
AF089541.1      -------------------AGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
AF089198.1      GAGGTAGTAATTAGATCCAAAAATTTCTCGGACAATGCTAAAATCATAATAGTACATCTA
                                     *** ** *  * ******* ** **** **** ** ** 
AF089134.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089265.1      AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
AF016818.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF089665.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF089541.1      AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
AF089198.1      AATGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
                *****  ****** *** ***************  ************** * *  **  *
AF089134.1      CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF089265.1      ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
AF016818.2      ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGATATAAGACAAGCA
AF089665.1      ATAGGACCAGGGAGAGCATTTTATGCAACAGGAAAGATAATAGGAGATATAAGACAAGCA
AF089541.1      ATAGGACCAGGCAGGGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
AF089198.1      ATAGGACCAGGCAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 ** ******* ** * **  *** ***** **   ****** *********** *****
AF089134.1      CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF089265.1      CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
AF016818.2      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF089665.1      CATTGTAACCTTAGTAGAACAAGATGGAATGACACTTTAAAACAGATAGTTTACAAATTA
AF089541.1      CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
AF089198.1      CATTGTAACATTAGTGAAGAAAAATGGAATGAAACTTTAAAAAAGATAGTTATAAAATTA
                 ******** *****  *      ****** * ****** **  * *** *   ******
AF089134.1      AGAGAACAATTTCAG---AATAAAACAATAGGCTTTAATCAATCCTCA
AF089265.1      AGAGAACAATTTAAG---AATAAAACAATAGTCTTTAATCAATCCTCA
AF016818.2      AGAGAACACTTTGGG---AATAAAACAATAGTCTTTAATCACTCCTCA
AF089665.1      AGAGAACAATTTGGGAATAATAAAACAATAATCTTTAATCAATCCTCA
AF089541.1      AAAGAACAATTTAGG---AATAAAACAATAGTCTTTAGTCCATCCTCA
AF089198.1      AGAGAACAATTTGGG---AATAAAACAATAGTATTTAATTCATCCTCA
                * ****** ***  *   ************   **** *   ******

Phylogenetic Tree

Non week5 act2-phylogenetic-tree.png

Activity 2

Part 1

Subjects and Clone Numbers
Subject Clone
Subject #3 Clone #1
Clone #2
Clone #4
Subject #6 Clone #1
Clone #2
Clone #3
Subject #9 Clone #1
Clone #3
Clone #5
Subject #12 Clone #1
Clone #3
Clone #4

Phylogenetic Tree Non week5 act2-actual-phylo-tree.png


CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S9V1-1          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTACAGCTG
S9V1-3          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S9V1-5          GAGGTAGTGATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATAATAGTGCAGCTG
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S12V1-4         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S12V1-1         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
S12V1-3         GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
                ** ***** ** *****    ***  * *  * ********** **** **** ** *  
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S9V1-1          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-3          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S9V1-5          AAAGAACATGTAGAAATAAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S12V1-4         AACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-1         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S12V1-3         AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
                **      ***** *** ***************  **************** *  **  *
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S9V1-1          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-3          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S9V1-5          ATAGGACCAGGGAGAGCATTTTATGCAACAGGAACAATAATAGGAGATATAAGACAAGCA
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-4         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-1         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S12V1-3         ATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAAGCA
                 ********** * ** **  *** ********  ******************* *****
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S9V1-1          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-3          CATTGTAACATTAGTGGAGCAAAATGGAATGACACCTTAAAACAGATAGTTGAAAAATTA
S9V1-5          CATTGTAACATTAGTGGAGCAAAATGGAAGGACACCTTAAAACAGATAGTTGAAAAATTA
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S12V1-4         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-1         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
S12V1-3         CATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTTATAAAATTA
                ********* ***** ***** * *****       ******  ***** *  *******
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S9V1-1          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-3          AAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S9V1-5          AGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S12V1-4         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-1         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATCCTCA
S12V1-3         AAAGAACAATTTAGGAATAAAACAATAGTCTTTAGTCCATTCTCA
                * ****  ****  ************** ***** **  * ****

For this part, I chose 4 random subjects and 3 clones from each of their first visits. The phylogenetic trees and clustal alignment tables were generated and are shown above.

  • In the phylogenetic tree, the clones from each of the subjects clustered together rather than clustering with clones of other subjects. This signifies that the clones of each subject are most closely related with each other versus any other clones.
  • Each of the subject's clones are all relatively similar to each , showing few nucleotide differences.
  • The subjects do not really cluster together, with all of them being clearly distinct from each other.
  • The tree produced 4 distinct clusters with each consisting of the respective subjects' visit data only. Also the tree distance between each of different subjects seems fairly long. Judging by both of these observations, it is hard to see any strong evolutionary data the brings the subjects together.

Part 2

For this next part, I chose 3 random subjects and analyzed all of their clones using their FASTA data. For each subject, I counted the number of clones and positions with nucleotide differences (S value) in the table below. The theta values were calculated by finding the harmonic sum (using this calculator) and dividing S by the found harmonic sum for each subject.

Diversity Quantification of Three Subjects
Subject Number of Clones S Theta
13 24 25 6.621
7 43 49 11.264
4 47 62 13.970


Subject 13 data

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S13V4-1         GAGATAGTAATCAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-3         GAGATAGTAATCAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-2_3       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAGTGCTAAAATCATAATAGTACAGCTG
S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V2-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATGATAGTACAGCTG
S13V3-7         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V2-1_9       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-2_4       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1_4       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V3-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-6_2       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V4-7         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4_2       GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
                *********** **** ***************** ******** *** ************
S13V4-1         AAGGAATCTGTAGAGATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-3         AAGGAATCTGTAGAGATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-2_3       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V4-4         AAGGAGTCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V2-2         AAGGAATTTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-7         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V2-1_9       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-2_4       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-1_4       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V3-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V4-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V4-6_2       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATACAT
S13V4-7         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-4_2       AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
                ***** * ****** ***************** ************************ **
S13V4-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-2_3       ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V4-4         ATAGGACCAGGGAGAGCATTTTATGCATCAAAAGGAATAATAGGAGATATAAGACAAGCA
S13V3-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V2-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-1         ATAGGACCAGGGAGAGCGTTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-4         ATAGAACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-7         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V2-1_9       ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-2_4       ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-1_4       ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V3-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-6_2       ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V4-7         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-4_2       ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
                ** * ************ ** ********** ****************************
S13V4-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-2_3       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGAAAGGTAGCTGCAAAATTA
S13V4-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGAAAGGTAGCTGCAAAATTA
S13V3-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-3         TATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V2-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-7         TATTGTAACACCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-2         TATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V2-1_9       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-2_4       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-1_4       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V3-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V4-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-6_2       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V4-7         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-4_2       TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
                ********** ********* ******** ********* ** *****************
S13V4-1         AGAGGACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-3         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA 
S13V4-2_3       AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-4         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAGTCAATCATCA
S13V5-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V2-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-5         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-7         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         AGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V2-1_9       AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-2_4       AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1_4       AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V3-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-5         AGAGAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-6_2       AGAAAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V4-7         AGAAAACAATTTGGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4_2       AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
                ***  *******  ******************** **********

Non week5 act2part2-sub13phylogenetictree.png

Subject 7 data

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment'

S7V5-5          GAGATAGTAATTAGATCTGCCGATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-4          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-6          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAGACCATAATAGTACAGCTG
S7V4-3_2        GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-1          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-2          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-6          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-10         GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-2          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S7V2-3          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-4          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V1-9          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-5          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTA
S7V2-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-7          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAAACCATAATAGTACAGCTG
S7V2-5          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V1-8          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAAACCATAATAGTACAGCTG
S7V5-2          GAGATAGTAATTAGATCTGCCGATTTCTCGGACAATGCTAAGACCATAATAGTACAACTG
S7V3-6          GAGGTAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V5-4          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-8          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-9          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-3          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAACTG
S7V5-6          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-1          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-7_2        GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V4-8          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAGACCATAATAGTACAGCTG
S7V3-2          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V3-7          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-4          GAGGTAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V3-5          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-8          GAGATAGTAATTAGATCTGCCTATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-1_3        GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V2-4          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V2-2_2        GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V2-6_2        GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V4-5          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-7          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V2-7          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V4-9          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
                *** ***************** **    ******** * ** ************** ** 
S7V5-5          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-4          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-6          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-3_2        AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-1          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-2          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-6          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT 
S7V1-10         AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-2          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACTT
S7V2-3          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-4          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-9          AGTGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-5          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
S7V2-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCGACAACAATACAAGAAAAAGTATACCT
S7V1-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-7          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V2-5          AAAGCACCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAAGGAAAAGTATATCT
S7V1-3          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V1-8          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-2          AATGCATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-6          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-4          AATGCATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-8          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGGAAAGTATATCT
S7V5-9          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-3          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-6          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-1          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAGTACAAGGAAAAGTATATCT
S7V5-7_2        AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-8          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-2          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAGAAGCATATCT
S7V3-7          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAATAACAATACAAGGAAAAGTATATCT
S7V3-4          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-5          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-3          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATACCT
S7V3-8          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-1_3        AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-4          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-2_2        AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-6_2        AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-5          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-7          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-7          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-9          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
                *  * * ** **************** ****** * **** ******   *** ***  *
S7V5-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-3_2        ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V1-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-10         ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGGAATATAAGACAAGCA
S7V1-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAGTAGGAAATATAAGACAAGCA
S7V5-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V3-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-7_2        ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V4-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-1_3        ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-2_2        ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-6_2        ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
                *************************************** ****  ******* ******
S7V5-5          CATTGTACAGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAGTTA
S7V4-4          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-6          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-3_2        CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-1          CATTGTAACGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-2          CATTGTACCGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-6          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-10         CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-3          CATTGTAACGCTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-4          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-9          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAGCAGATGGCTACAAAATTA
S7V1-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-7          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-3          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-8          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V5-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAGTTA
S7V3-6          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGCAACGAAATTA
S7V5-4          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-8          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-9          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-6          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-7_2        CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-8          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-2          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-4          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-5          CATTGTAACATTAGTAGGACAAAATGGAGTAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-3          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-8          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-1_3        CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-4          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-2_2        CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-6_2        CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-5          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-9          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
                *******     * ***   ******** ************ ***** *  ** ** ***
S7V5-5          AGAGAAAAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-4          AGAGAACAATTTAGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-6          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-3_2        AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-1          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-2          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-6          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-10         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-2          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V2-3          AGAAAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-4          AGAAACCAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-9          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-7          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-8          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-2          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V3-6          AGAGAACAATTTGAGAATAAAACAATAATCTTTAAGCAATCCTCA
S7V5-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-9          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-3          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-6          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-1          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-7_2        AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V3-2          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-7          AGAGAAAAATTTGAGAATAAAACAATAATCTTTAAGCAATCCTCA
S7V3-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-5          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-3          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-1_3        AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-2_2        AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-6_2        AGAGAAAGATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-5          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-7          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-7          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-9          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
                *** *   ****  ************* ******* ***** ***

Phylogenetic Tree'

Non week5 act2part2-sub7phylogenetictree.png


Subject 4 data

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S4V2-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-16         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-8          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-2          GAGGTTGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-5          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-9          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-11_2       GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-17         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-5_4        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-14         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-18         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-3_3        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-2_11       GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-4_2        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-6          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-12         GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-1_2        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-15         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAACAGTACAGCTG
S4V2-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-12         GAGGTAGTAGTTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-3_4        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
                ***** *** *************  **** *** *************** **********
S4V2-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACCT
S4V4-4          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V4-13         AATGAATCTGTAGAAATTAATTGTACAAGACCTGACAACCATACAGTAAGAAAGATACCT
S4V3-16         AATAAATCTGTAGGAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-11_2       AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V3-17         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAGTATACCT
S4V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACACGACAACAATACAGTAAGAAAGATACCT
S4V4-5_4        AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACGAAGAAGTATACCT
S4V3-14         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACAT
S4V3-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-10         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-13         AATGAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-18         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V1-3_3        AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-1          AATAAATCTGTAGAAATCAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V4-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAATAAGAAGGATACCT
S4V2-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-2_11       AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V3-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAAGATACCT
S4V4-1          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-4_2        AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACAATACAGTAAGAAAGATACCT
S4V4-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-1_2        AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-15         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V2-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAGGATACCT
S4V2-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V2-13         AATGAATCGGTAGAAATTAATTGTACAAGACCCAACAACCATACAATAAGAAAGATACCT
S4V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V3-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-3_4        AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V3-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACCATACAGTAAGAAAGATACCT
S4V2-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACACCAATACAGTAAGAAAGATACCT
S4V2-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
                *** ****  *** *** *************   **  * *****  ** **  **** *
S4V2-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAAAAAATATAAGGCAAGCACAT
S4V4-4          ATAGGACCCGGCAGAGCATTTTATACAACAGGCAGAATAGGCAATATAAGGCAAGCTCAT
S4V4-13         ATAGGACTAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V3-16         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGCGATATAAGGCAAGCACAT
S4V4-8          ATAGGACCAGGGAGTTCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V4-2          ATAGGACCAGGGAGATCATTTTATACAACAGGCATAGTAGGAGATATAAGGCAAGCACAT
S4V3-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-11_2       ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-17         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGACATAAGGCAAGCACAT
S4V4-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGTAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-5_4        ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V4-10         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCTCAT
S4V2-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-14         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-18         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V1-3_3        ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V1-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V4-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAAATATAAGGCAAGCACAT
S4V2-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-11         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V1-2_11       ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-2          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V3-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V4-1          ATAGGACCCGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-4_2        ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-6          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-11         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-12         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-9          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V3-1_2        ATAGGACCAGGGAGTTCATCTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-15         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-3_4        ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-2          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-4          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
                *******  ** **  *** ************   * **    * ******* *** ***
S4V2-6          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAAA
S4V4-4          TGTAACATTATTGAAGCAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-13         TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-16         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGTTAACAAATTAAGA
S4V4-8          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-2          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGCTAACAAATTAAGA
S4V3-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-11_2       TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-17         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-5_4        TGTAACATTAGTAAAACAAAACGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA 
S4V2-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-14         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-18         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V1-3_3        TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGTTAACAAATTAAGA
S4V1-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-11         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGG
S4V1-2_11       TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V3-4_2        TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V4-11         TGTAACATTAGTAGAACAAAATGGAACAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-1_2        TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-15         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-3_4        TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V2-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-4          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
                ********** *  * ***** **** *** ********** ** * ***********  
S4V2-6          AAACAATTTAAAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-4          GAACAGTTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-16         GAACAATTTAGGAATAAAACAATAATCTTTAGTCAATCCCCA
S4V4-8          GAACAATTTAGAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-5          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-11_2       GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-17         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-5_4        GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-10         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA 
S4V3-14         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-8          GAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S4V3-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-18         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-3_3        GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-1          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-11         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-2_11       GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-5          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-3          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-1          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-4_2        GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-11         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-1_2        GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-15         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-1          GAACAATTTAGGAATGAAACAATAATCTTTAATCAATCCTCA
S4V2-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-12         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-13         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-8          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-3_4        GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-2          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-4          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
                 **** ***   *** ******** ****** ******* **

Phylogenetic Tree

Non week5 act2part2-sub7phylogenetictree.png

Activity 3

Question: How does the location and identity of nucleotide differences observed in HIV clones in subjects with a similar slope of divergence affect virulence? (copied from Carolyn)

Hypothesis: I hypothesize that if a certain segment/location is mutated, there will be stronger effects on virulence. I also hypothesize that specific nucleotide differences/changes won't matter to actual virulence as much as the simple act of mutating.

Subjects: We will analyze all of the clones from first and last visit data for a currently undefined number of subjects. We believe the first and last visit will provide the necessary information to answer the hypothesis since the slope of divergence measures a rate over time. By looking the number of changes over the full span of time, we believe this will accomplish our goal.

Data/Files

Images

Scientific Conclusion

Phylogenetic trees are useful tools in seeing the relation between the genetic sequences of subject. Clustal sequences allow for determining the exact changes as well number of changes in their genetic sequences between groups of subjects.

Acknowledgements

  • I worked with my partner Carolyn to formulate a research question, hypothesis and possible subject data for further analysis.
  • I worked with Maya in class, helping each other go through the assignment and optimize the best way to enter/find the data.
  • I used the Week 5 Protocol to go through this assignment.
  • I copied the table formatting for two tables from the Week 5 Protocol
  • "Except for what is noted above, this individual journal entry was completed by me and not copied from another source."

Non (talk) 23:03, 19 February 2020 (PST)

References