Dcartmel Week 6

From OpenWetWare
Jump to navigationJump to search

User Page Link

Template Page Link

Assignment Pages

Individual Journal Pages

Shared Class Journal Pages

Purpose

The purpose of this assignment is to investigate whether there exists a common mutation or location of a mutation that can be identified and used to differentiate between rapid progressors and non-progressors. Finding a common mutation can allow for future efforts of treatment to be more focused on particular parts of the gene rather than the entire HIV-1 env sequence.

Combined Methods/Results

  • We are choosing our subjects based on dS/dN values that they have
    • For the rapid progressors, we are choosing subjects that have low dS/dN values. These will include subjects 10, 3, and 1.
    • For the non-progressors, we are choosing subjects that have high dS/dN vlaues. These will include subjects 2 and 13.
    • We will be analyzing a total of 78 sequences from all of the chosen subjects.
      • 34 will be from first visits and 44 will be from the last visits.
    • Retrieved sequence data of chosen subjects from Bioquest.org
  • Used website www.phylogeny.fr to align sequences.
    • Aligned clones from all of the first visits of all of the chosen subjects.
    • Used alignment in clustal format
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S13V1-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG 
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                **  ******* ***** *  ****** *  ******** *** **** ** ********
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S13V1-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                 *   * ****** *** **  * ********   ************** ***  **  *
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S13V1-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGGAATAATAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-1         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S1V1-13         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
S1V1-2          ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S1V1-10         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-8          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-12         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-11         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 *  * ***** * ** **  **  ** ** **   **** * **********    ***
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S13V1-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S1V1-13         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAATTA
S1V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S1V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-10         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAATTA
S1V1-1          TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S1V1-7          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-12         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-11         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAATTA
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ******** * **** * ** * *** ** ** * ***       *** *   ***** 
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S13V1-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V1-13         AGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          AGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V1-5          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S1V1-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                 ******* ***   **    ******  ***** *** ** ***

Aligned sequences from subjects' last visits:

S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S10V6-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-6         GAGGTAGCAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-8         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                **  *** * * ** *  *  *** **    ************ **** ******* *  
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S10V6-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAATAACAATACAAGAAGAAGTATA---
S10V6-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-4         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATC---
S10V6-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATA---
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATA---
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATA---
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATA---
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                **  *  *****   ** * *** *  * ****   ******* **    ***  *    
S3V6-2          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-4          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-5          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-3          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-6          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-1          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S13V5-3         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-6         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-4         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-2         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-5         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-1         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S10V6-2         AATATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-3         AATATGGGACCAGGGAGAGCATTGTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-7         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-6         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-8         AATATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-9         AATATGGGACCAGGGAGAGTATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-10        AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-1         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-4         AATATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-5         ACTATGGGACCAGGGAGAGCATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S1V5-2          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          AATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S2V4-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-8          CATATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAA
S2V4-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-2          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                  * *  ******* ***  **  *** *      *      * *   ** ****    *
S3V6-2          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-4          GCACATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-5          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-3          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-6          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAA
S3V6-1          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S13V5-3         GCATATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-6         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAA
S13V5-4         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAA
S13V5-2         GCATATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-5         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-1         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S10V6-2         GCACATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGCTGTCGACAAA
S10V6-3         GCACATTGTAACATTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-7         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAA
S10V6-6         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-8         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-9         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-10        GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-1         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-4         AGATATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-5         AGATATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGGTGCTGACAAA
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S2V4-3          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-5          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-8          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-1          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S2V4-2          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S2V4-4          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-7          GCACATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-6          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-9          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                  * ******** * ***  * *     ** *   *******  *      *     ***
S3V6-2          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TTATGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S13V5-3         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         TTAAGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S10V6-2         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-3         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-7         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTACTCAATCCTCA
S10V6-6         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-8         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-9         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-10        TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-1         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-4         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-5         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-3          TTAAGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          TTAAGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          TTAAGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** ** ****  *   ***    ******  *****  ** ** ***

Generated Phylogenetic Tree of First and Last Visits from Subjects Chosen for Study.PNG

This is the phylogenetic tree that was generated using the sequences of the first and last visits of all of the subjects.

Used website www.phylogeny.fr to create phylogenetic tree.

Aligned sequences for first visit nonprogressors:

S13V1-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                *** ************* *********** ********* ******************** 
S13V1-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ** *****************************   ************** ******* **
S13V1-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA 
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                ** ******** ******** *** ** ** ***  ****** *****************
S13V1-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA 
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
                *********** **** **** ***** ***** *****  **** *** *  ****** 
S13V1-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
                ******** *** * ***   ************* *** ** ***

Aligned sequences for last visit of nonprogressors:

S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                *** ************  *********** ************* **************  
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT 
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATACAT
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ** ** ***************** **** ****  *************  ******* **
S13V5-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-4         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA 
S2V4-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-8          ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAAGCA
S2V4-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                *** ******* ************ ** ** **   ****** **** ************
S13V5-3         TATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-2         TATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S2V4-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA 
S2V4-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ********** **** ***  ***** * *********  **** *** *  *******
S13V5-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         AGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S2V4-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** **** ***  ****   *************  ** ** ***

Aligned sequences for first visit rapid progressors:

S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ** ******** ***** *  ****** ** ************ **** ** ********
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                 **  * ****** *** **  * *********  ************** ***  **  *
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGGAATAATAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-1         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S1V1-13         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
S1V1-2          ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S1V1-10         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-8          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-12         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-11         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 *  * ***** * ** **  ** *********   **** * **********    ***
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S1V1-13         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAATTA
S1V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S1V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-10         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAATTA
S1V1-1          TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAATTA
S1V1-7          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-12         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-11         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAATTA
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ******** ******** ** * *** ** **** ****      *** *   ******
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V1-13         AGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          AGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V1-5          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                 ******* ***   ** *********  ********* ** ***

Aligned sequences for last visit rapid progressors:

S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S10V6-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-6         GAGGTAGCAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-8         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                **  *** * * ** ** *  *** **    ************ **** ******* ***
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
S10V6-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAATAACAATACAAGAAGAAGTATAA--
S10V6-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAA--
S10V6-4         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATCA--
S10V6-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATAA--
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATAA--
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATAA--
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATAA--
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATAA--
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATAA--
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                *** ** *****   ** * *** *  ******   ******* **    ***  * *  
S3V6-2          -CTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-4          -CTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-5          -CTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-3          -CTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-6          -CTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-1          -CTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S10V6-2         -ATATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-3         -ATATGGGACCAGGGAGAGCATTGTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-7         -ATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-6         -ATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-8         -ATATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-9         -ATATGGGACCAGGGAGAGTATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-10        -ATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-1         -ATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-4         -ATATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-5         -CTATGGGACCAGGGAGAGCATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S1V5-2          -ATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          -ATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          -ATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         -ATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         -ATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                  * *  ******* ***  **  *** * *    * *    * **  *******    *
S3V6-2          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-4          GCACATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-5          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-3          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-6          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAA
S3V6-1          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S10V6-2         GCACATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGCTGTCGACAAA
S10V6-3         GCACATTGTAACATTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-7         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAA
S10V6-6         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-8         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-9         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-10        GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-1         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-4         AGATATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-5         AGATATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGGTGCTGACAAA
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                  * ******** ***** ** *     ** **  ******* **      *     ***
S3V6-2          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TTATGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S10V6-2         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-3         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-7         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTACTCAATCCTCA
S10V6-6         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-8         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-9         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-10        TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-1         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-4         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-5         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** ** ****  *   *** *********  *****  ** ******
Table 1: S values of the aligned sequences of nonprogressors
Window First Visit Last Visit
1 1 1
2 2 3
3 1 1
4 0 2
5 1 2
6 0 2
7 3 2
8 2 3
9 2 2
10 3 2
11 4 5
12 0 1
13 1 2
14 3 5
15 3 2
16 5 4
17 3 4
18 3 3
19 3 4
Table 2: S values of the aligned sequences of Rapid Progressors
Window First Visit Last Visit
1 2 6
2 4 7
3 2 2
4 2 2
5 5 5
6 4 5
7 2 4
8 5 9
9 6 6
10 4 6
11 5 10
12 4 6
13 2 4
14 4 7
15 7 4
16 5 10
17 5 5
18 3 3
19 2 5


S value graph rapid .png

This is a graph showing the s values for the rapid progressors Graph generated using excel.

This graph shows the comparison of S values between the first and last visits of the rapid progressor group.

S value graph non progressors .png

Graph generated using excel.

This graph shows the comparison of S values between the first and last visits of the non-progressor group.

Link to presentation File:Bioinformatics Presentation 1.pdf

Scientific Conclusion

The results of our research project showed that based on the comparison of the s values from the first and last visits of the rapid progressor subjects with the first and last visits of the non-progressor groups, there was no particular region on the HIV-1 env sequence that could be recognized as a common characteristic of rapid HIV-1 progression. However, window 11 on the rapid progressor sequences could potentially be a spot that could be focused on in future experiments because it slightly more variance than the other windows. The phylogenetic tree demonstrated that there was no rapid progression mutation that existed between the subjects that were chosen for this project. The graphs that were created showed that there was an overall increase in diversity between the first and the last visits in both the non-progressors and rapid progressors, however, other than potentially window 11, this diversity did not occur at any particular locations on the rapid progressor gene.

Acknowledgements

I worked with my homework partner Jack P. Menzagopian to complete this research project. We worked in class on 2/20/20 and texted each other on 2/20/20 and 2/22/20 to compete the graph of the data. We texted each other from 2/24/20-2/26/20 to work on the presentation.

Copied the syntax for making table from https://en.wikipedia.org/wiki/Help:Table

I copied and modified the Week 6 page.

I met with the professor, Kam D. Dahlquist, Ph.D. during office hours on 2/25/20 to discuss the statistical analysis for the data of this project.

Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Dcartmel (talk) 20:11, 26 February 2020 (PST)

References

OpenWetWare. (2020). BIOL368/S20:Week 6. Retrieved February 26, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_6.

Phylogeny.fr. (2020). Retrieved February 20, 2020 from http://www.phylogeny.fr/.

Bioquest.org. (2015). Bedrock HIV Problem Space: Amino Acid Sequences. Retrieved February 20, 2020 from http://bioquest.org/bedrock/problem_spaces/hiv/nucleotide_sequences.php.

Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. doi: 10.1073/pnas.95.21.12568