Dcartmel Week 5

From OpenWetWare
Jump to navigationJump to search

User Page Link

Template Page Link

Assignment Pages

Individual Journal Pages

Shared Class Journal Pages

Purpose

The purpose of this assignment is to practice using the bioinformatics tools in order to thoroughly and efficiently compare the various sequences found in the data from the Markham et al paper.

Combined Methods/Results

Activity 1: Looking at the NCBI Resources and HIV sequence data

Part 1: PubMed

How did you search for the PubMed entry?

  • I searched for the PubMed entry by entering the name of the article into the search bar.

What other ways might you have searched?

  • Other ways to search for this article could have been to enter particular keywords that are relevant to the article such as HIV-1 evolution or CD4 T cell decline.

What other types of related information are available?

  • Available on this page is the abstract of the paper, all of the figures included in the paper, and information about the substances used as well as links to GENBANK for all of the nucleotide sequences involved in this study.

Used NCBI website: http://www.ncbi.nlm.nih.gov

Part 2: Gen Bank

What was the accession number of the sequence you chose?

  • AF089153

Which subject of the study was that HIV sequence from?

  • Subject 4, visit 2, 3rd clone.

Which section of the record contains information about who the HIV was collected from?

  • The definition section of the of the nucleotide page.

Part 3: Introduction to Phylogeny.fr

AF0891_a        GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
AF0891_b        GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
AF089153.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
AF016818.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
AF016767.2      GGGGTAGTAATTAGATCCGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
                *   ************* *  ****** *  ************  *** ********** 
AF0891_a        AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF0891_b        AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
AF089153.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
AF016818.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
AF016767.2      AATGAATCTGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ****** *****  *** ***************  **** *****  ** **   **  *
AF0891_a        CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF0891_b        CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
AF089153.2      ATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCAAGCA
AF016818.2      ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGATATAAGACAAGCA
AF016767.2      ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
                 ** ******* **** **  ***** *** *    * **** **********   ****
AF0891_a        CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF0891_b        CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
AF089153.2      CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTA
AF016818.2      TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
AF016767.2      TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
                 ******** ******** **   *** *********** **  ***** **  ******
AF0891_a        AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
AF0891_b        AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
AF089153.2      AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
AF016818.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
AF016767.2      AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
                ******** ***  *************  ********* ** ***

Drew Cartmel Part 3 tree.png


Used website www.phylogeny.fr

Activity 2:Looking at the sources of HIV across subjects

Part 1: Looking at clustering across subjects

Table 2
Subject Clone #
Subject 1 S1V1-1
S1V1-2
S1V1-3
Subject 2 S2V1-1
S2V1-2
S2V1-3
Subject 3 S3V1-1
S3V1-2
S3V1-3
Subject 4 S4V1-1
S4V1-2
S4V1-3


Used data from Visit_1_Subjects_1_thru_9_HIV.txt

Sequence alignment for 12 sequences

S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S4V1-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ** ************** *  ****** ** ******** ***  *** ***********
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S4V1-1          AATAAATCTGTAGAAATCAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                *** ** ****** *** ***************  *********** ** ***  **  *
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S4V1-1          ATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCCAGCA
S4V1-2          ATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCAAGCA
S4V1-3          ATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCCAGCA
S1V1-2          ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S1V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 ** ******* * ** **  ** ********    * **** **********   ****
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S4V1-1          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTA
S4V1-2          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTA
S4V1-3          CATTGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGTTAACAAATTA
S1V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-1          TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
                 ******** ******** ** * *** ***** ********  ***** **  ***** 
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S4V1-1          AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-2          AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-3          AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V1-2          AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                ******** ***  *************  ***** *** ** ***

Drew Cartmel activity 2 part 1 tree.png

Do the clones from each subject cluster together?

  • Yes the clones from each subject do cluster together.

Do some subjects' clones show more diversity than others?

  • Yes, some of the clones do show more diversity than others. For example, the clones from subject one seem to be more diverse than the clones from subject 2.

Do some of the subjects' clones cluster together?

  • Yes, the clones from subjects one and two are clustered together.

Write a brief description of your tree and how you interpret the clustering pattern with respect to the similarities and potential evolutionary relationships between subjects' HIV sequences.

  • The clones from subject three were the most different in terms of evolutionary relationships with the clones from the other two subjects. Subjects one and two had clones that were very closely related as can be determined by their clustering in close branches in the tree. The clones from subject four were more closely related to the clones of subjects one and two than to the clones of subject three.

Part 2: Quantifying diversity within and between subjects

Subject 1:

S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-12         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-14         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-15         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-13         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-16         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                ********* **** ** *  *** **    **********   ************ ***
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATA---
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-6          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACGAGAAAAAGTATA---
S1V2-11         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATA---
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-12         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-10         AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-1          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-14         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-15         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-4          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-13         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-16         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                 **  * ** **   ****  ****  ****************  *    *** ***   
S1V5-2          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          AATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-11         CATATAGGACCAGGTAGGGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-2          CATATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAA
S1V1-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-11         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-14         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-15         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-16         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-2          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                 ***** **********  ********** *    ***    * *   ******* **  
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V1-13         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-4          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAA
S1V2-6          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-11         GCACATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGCTATAAAA
S1V1-5          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAA
S1V2-5          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACGCTTTAAAACAGATAGTTATAAAA
S1V1-2          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-10         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAA
S1V1-6          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAA
S1V2-10         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-7          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-8          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-9          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-11         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAA
S1V1-3          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-9          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-7          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-1          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-1          GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-14         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-15         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-4          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-8          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-13         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-16         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-2          GCTCATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-3          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                **  ************** ** **    ** ***** * ***      **** **  ***
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-13         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          TTAAGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V2-6          TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCATTCCTCA
S1V2-11         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-5          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-5          TTAAGAGAACGCTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-12         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          TTAAGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-6          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-9          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-7          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V2-14         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-15         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-4          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-8          TTAGGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-13         TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-16         TTAAAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-2          TTAAAAGAACAACTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-3          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                ***  * ***   *    ** ***************** ** ** ***

Subject 2:

S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-4          GAGGTAGTAATTAGATCCGAAAATTTCATGAGCAATGCTAGAATCATAATAGTACAGCTG
S2V3-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S2V3-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ***************** ********** ** *******  *** *************  
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-3          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATACAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-1          AATGGATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-7          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V3-8          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V3-5          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACGAGAAAAAGTATACAT
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ***   ***************** ****  ************** *** ***********
S2V4-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-8          ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAAGCA
S2V4-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V3-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-8          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                *** ************************** ** ******** **** ************
S2V4-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V3-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V3-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTCAAAACAGATAGTTAAAAAATTA
S2V3-8          CATTGTAACATTAGTAGAGCAGAGTGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V3-5          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
                 ******************** * ********* *** ************** ****** 
S2V4-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-3          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V3-1          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-9          AGAGAACACTTTGGGAATAAAACAATCGTCTTTAATCACTCCTCA
S2V3-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-7          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-5          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** **** ***   *********** *******  *********

Subject 3:

S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ********************************** *** ************** ******
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ******** **** ****** ** ** * *************** ***** *********
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                 ****************** *******  ****** *********

Data retrieved from Nucleotide Sequence Data

Used this site to calculate Theta: math.utah.edu.


Table 3
Subject Number of Clones S Theta
1 16 89 26.33
2 9 36 12.76
3 10 42 14.38


Activity 3: Defining your HIV evolution research project

  1. Comparing the sequences from the first and last visits of rapid progressors using alignment and phylogenetic trees, is there a common mutation in a specific location or particular sequence that can be focused on and used to distinguish between rapid progressors and non-progressors?
  2. If the sequences from the first and last visits of rapid progressors are analyzed using alignment tools and phylogenetic trees, a common mutation will be found that can be generalized to distinguish between individuals belonging to rapid and non-progressor groups.
  3. We will use the rapid progressor subjects which include subjects 4, 10, 11, 15, 3, and 1. We will focus on the clones that are present on the first and last visits within this particular group of subjects. We are going to chose the subjects from just the rapid progressor group because this is the group most effected by the virus. We also want to look for mutations that might be common within all of these individuals so that if we do find a commonality, then we might be able to isolate this particular mutation and focus on only it instead of an entire sequence. We are using the first and last visits because we think that comparing the clones from the beginning and end will give us a good idea of any possible common aspects within the sequences.

Data and Files

Drew Cartmel Part 3 tree.png

Drew Cartmel activity 2 part 1 tree.png


Scientific Conclusion

In this assignment, skills of comparing and visualizing data were practiced using the various bioinformatics tools that are available in the assignment outline. Through this assignment, I become more comfortable with these bioinformatics tools and was also able to come up with an individual research topic based on the original ideas set fourth in the Markham et al paper. Using these bioinformatics tools, my partner and I will further investigate our individual research topic.

Acknowledgements

I worked with my partner Jack P. Menzagopian on completing Activity 3 in the assignment outline. We worked together in class on 2/13/20 to formulate a question that we will investigate in our individual research project.

My partner and I consulted with our professor Kam D. Dahlquist, Ph.D. in class on 2/13/20 regarding our research topic.

I copied the syntax for creating table 2 and table 3 from the Week 5 assignment page.

I copied and modified the Week 5 page.

Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Dcartmel (talk) 20:45, 19 February 2020 (PST)

References

OpenWetWare. (2020). BIOL368/S20:Week 5. Retrieved February 19, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_5

NCBI.gov. (2020). Retrieved February 19, 2020 from https://www.ncbi.nlm.nih.gov/

Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. Retrieved February 19, 2020 from https://www.pnas.org/content/95/21/12568.long

Phylogeny.fr. (2020). Retrieved February 13, 2020 from http://www.phylogeny.fr/.

Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. Data retrieved February 13, 2020 from Visit_1_Subjects_1_thru_9_HIV.txt.

Bioquest.org. (2015). Bedrock HIV Problem Space: Amino Acid Sequences. Retrieved February 13, 2020 from http://bioquest.org/bedrock/problem_spaces/hiv/nucleotide_sequences.php.

Math.Utah.Edu. (2020). The harmonic series. Retrieved February 19, 2020 from https://www.math.utah.edu/~carlson/teaching/calculus/harmonic.html.