BioMicroCenter:DNA HTL: Difference between revisions
No edit summary |
|||
| Line 54: | Line 54: | ||
!colspan=2|Plate setup | !colspan=2|Plate setup | ||
|- | |- | ||
| Batch Size || | | Batch Size || 44* | ||
|- | |- | ||
| Sample Layout || Columns from left | | Sample Layout || Columns from left | ||
| Line 68: | Line 68: | ||
| Additional services available <BR> can be added if samples are not submitted as above | | Additional services available <BR> can be added if samples are not submitted as above | ||
| | | | ||
* Sample setup (per | * Sample setup (per 44) | ||
* SPRI cleanup (if not clean in proper buffer) | * SPRI cleanup (if not clean in proper buffer) | ||
|- | |- | ||
|colspan=2| * The BioMicro Center *strongly* encourages | |colspan=2| * The BioMicro Center *strongly* encourages leaving space for 4 control samples within each batch of 48. | ||
|} | |} | ||
Revision as of 13:22, 20 April 2017
| HOME -- | SEQUENCING -- | LIBRARY PREP -- | HIGH-THROUGHPUT -- | COMPUTING -- | DATA MANAGEMENT -- | OTHER TECHNOLOGY |
The BioMicro Center offers high-throuhgput DNA library preparation for NexteraXT samples and for metagenomics/amplicon generation. High-throughput library generation is different from standard library preparation in a couple key ways. First, with dozens of samples to prepare, small numbers of samples may fail and the cost of reprepping those samples is NOT included in the quoted cost. For some experiments, repreps can be done by hand, but at a higher rate. Second, we are focused far more on reducing price than for standard library preparation, so some "routine services" - such as quality control or arraying of samples - is not built in.
High-Throughput and Very-High Throughput Nextera XT
To minimize library prep costs for standard Illumina libraries, we have automated Illumina NexteraXT on our Tecan EVO150s and on our TTP Mosquito. Libraries will be built to include variable i5 and i7 indexes based on the grid so dual indexing is required during sequencing of these libraries. For more information about how Nextera works, please check out the standard Nextera library preparation section of standard DNA library prep.
Libraries prepared on the Mosquito use a significantly lower volume for preparation. This allows for significantly reduced costs but also lowers the complexity. As such, is it most suitable for single cell and amplicon analysis. De novo work should not be done using the reduced volume Mosquito preps.
| Plate setup | |||
|---|---|---|---|
| Batch Size | 16 HT Standard NexteraXT |
96 Reduced volume XT |
384 Reduced volume XT |
| Sample Layout | Columns from left | quads on 384w plate | full 384w plate |
| Volume | >7ul | 5ul | 5ul |
| Concentration | 0.2ng/ul* | ||
| Buffer | H2O or 10mM Tris 8.0. no organics! | ||
| Plate | Axygen 96well (CAT#) | Obtain plate from BMC | |
| Additional services available can be added if samples are not submitted as above |
| ||
| * For short PCR fragments, lower concentrations are required. Please speak with BMC staff for amplicons. | |||
16S / Amplicon Sequencing

The BioMicro Center offers 16S amplicon sequencing for metagenomics projects. Derived from the Alm Lab with support from a pilot grant from MIT CEHS, our protocol uses a two step amplification to first expand the 16S population and add defined 3' and 5' sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost.
The adapter sequences - Green:Blue - are the key element of this method. On the 5' end, they contain a "YRYR" sequence that introduces the complexity required for Illumina sequencing.
FORWARD: ACACGACGCTCTTCCGATCTYRYRXXXXXXXXXX (X = insert element) REVERSE: CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXXXXXXXXXXX

Standard BioMicro Center primers include sequences for the V4 region (highlighted). We have recently acquired the primers for v1-3 as well. Similar strategies can be used to amplify 18S or any other sequence.
The most common source of failures for 16S sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR using the forward and reverse primers to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally preform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. The BioMicro Center generally recommends 250PE or 300PE MiSeq kits for sequencing 16S libraries.
| Plate setup | |
|---|---|
| Batch Size | 44* |
| Sample Layout | Columns from left |
| Volume | >5ul |
| Concentration | Iniital qPCR for target has Ct < 20 |
| Buffer | H2O or 10mM Tris 8.0. no organics! |
| Plate | Axygen 96well (CAT#) |
| Additional services available can be added if samples are not submitted as above |
|
| * The BioMicro Center *strongly* encourages leaving space for 4 control samples within each batch of 48. | |