Jmenzago Week 6

From OpenWetWare
Jump to navigationJump to search

Purpose

This research assignment seeks to find a location on the env gene of HIV-1 that differentiates rapid progressors from nonprogressors, with the hopes of locating a region that can be targeted for efficient treatment of HIV. If mutations occur frequently within a specific location on the env gene of rapid progressor strains and not as frequently in nonprogressors, then that region can be targeted to develop more efficient treatment methods.

Methods/Results

Subject Selection

  • Five subjects selected for analysis based on dS/dN values
    • Only rapid and nonprogressors chosen
    • Subjects with the two highest and two lowest non-zero dS/dN values selected
    • Subject 3 selected because dS/dN value was 1.0
      • If dS/dN theory is correct, the perfect ratio would indicate that the strain is a moderate progressor, but Subject 3 was classified as a rapid progressor
    • Total of 78 clones analyzed
      • 34 from first visit
      • 44 from last visit
Table 1
Subject Progression Median dS/dN
1 Rapid 0.3
2 Non 1.8
3 Rapid 1.0
10 Rapid 0.2
13 Non 3.5

Comparison of Sequences

  • Align all sequences from the first visit for each subject and all sequences for the last visit for each subject for the nonprogressors
    • Align on www.phylogeny.fr
      • "One Click" under "Phylogeny Analysis"
      • Upload FASTA sequences for subjects in Table 1 from first visit and submit.
        • Export alignment as clustal format
      • Upload FASTA sequences for subjects in Table 1 from last visit and submit.
        • Export alignment as clustal format
  • Repeat for rapid progressors
  • Aligned sequences for first visits of nonprogressors:
S13V1-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                *** ************* *********** ********* ******************** 
S13V1-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ** *****************************   ************** ******* **
S13V1-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA 
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                ** ******** ******** *** ** ** ***  ****** *****************
S13V1-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA 
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
                *********** **** **** ***** ***** *****  **** *** *  ****** 
S13V1-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
                ******** *** * ***   ************* *** ** ***
  • Aligned sequences for last visit of nonprogressors:
S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                *** ************  *********** ************* **************  
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V5-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT 
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATACAT
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ** ** ***************** **** ****  *************  ******* **
S13V5-3         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-6         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-4         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-5         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V5-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA 
S2V4-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-8          ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAAGCA
S2V4-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                *** ******* ************ ** ** **   ****** **** ************
S13V5-3         TATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-6         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAATTA
S13V5-2         TATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-5         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V5-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S2V4-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA 
S2V4-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ********** **** ***  ***** * *********  **** *** *  *******
S13V5-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         AGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S2V4-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** **** ***  ****   *************  ** ** ***
  • Calculate the S values per bins of 15 nucleotides (5 codons) for each aligned sequence
    • S values summarized in Table 2 and Table 3
    • The aligned sequences from the last visit have one more codon than those from the first visit (288 nucleotides vs. 285 nucleotides), so it was not counted
      • the extra codon had no invariants, should not impact the outcome of this experiment
Table 2: S values of the aligned sequences of nonprogressors
Window First Visit Last Visit
1 1 1
2 2 3
3 1 1
4 0 2
5 1 2
6 0 2
7 3 2
8 2 3
9 2 2
10 3 2
11 4 5
12 0 1
13 1 2
14 3 5
15 3 2
16 5 4
17 3 4
18 3 3
19 3 4
Table 2: S values of the aligned sequences of Rapid Progressors
Window First Visit Last Visit
1 2 6
2 4 7
3 2 2
4 2 2
5 5 5
6 4 5
7 2 4
8 5 9
9 6 6
10 4 6
11 5 10
12 4 6
13 2 4
14 4 7
15 7 4
16 5 10
17 5 5
18 3 3
19 2 5
  • Generate a graph plotting the S value vs. the bin number for the first and last visit for both the nonprogressors and rapid progressors
  • Graphs were generated using Excel
    • Graph for S values of nonprogressors

S value graph non progressors .png

    • Graph for S values of rapid progressors

S value graph rapid .png

  • No window showed clear favor for mutations
  • It is possible that window 11 is a favored target for mutation
    • nonprogressors only had a difference of 1 invariant between visits
    • rapid progressors had a difference of 5 invariants between sequences

Generation of Phylogenetic Tree

  • Generate a phylogenetic tree for all the clones from the first and last visits for the subjects chosen for the study
    • Tree will show if rapid progressors showed similar mutations, suggesting that certain mutations code for rapid progression
    • Generate tree on www.phylogeny.fr
      • "One Click" under "Phylogeny Analysis"
      • Upload FASTA files of all sequences for the first and last visits of subjects chosen for the study and submit, tree will generate
  • Phylogenetic tree for all clones of HIV-1 from the first and last visits for the subjects chosen for this study:

Generated Phylogenetic Tree of First and Last Visits from Subjects Chosen for Study.PNG

  • Aligned sequences for first visits from subjects used for tree:
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S13V1-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-3         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V1-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG 
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                **  ******* ***** *  ****** *  ******** *** **** ** ********
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S13V1-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATAAAT
S13V1-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S13V1-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCTGGCAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                 *   * ****** *** **  * ********   ************** ***  **  *
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S13V1-2         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-3         ATAGGACCAGGGAGAGCATTCTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-4         ATGGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S13V1-1         ATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGGAATAATAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-1         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S1V1-13         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
S1V1-2          ATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S1V1-10         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-8          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-12         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAGGCA
S1V1-11         ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                 *  * ***** * ** **  **  ** ** **   **** * **********    ***
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S13V1-2         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-3         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-4         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S13V1-1         TATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S1V1-13         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAATTA
S1V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S1V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-10         TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAATTA
S1V1-1          TATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S1V1-7          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-12         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-11         TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAATTA
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
                 ******** * **** * ** * *** ** ** * ***       *** *   ***** 
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S13V1-2         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-3         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-4         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V1-1         AGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V1-13         AGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          AGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V1-5          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          AGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S1V1-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                 ******* ***   **    ******  ***** *** ** ***
  • Aligned sequences for last visits from subjects used for tree:
S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S13V5-3         GAGATAGTAATTAGATTTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-6         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S13V5-4         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-2         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-5         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S13V5-1         GAGATAGTAATTAGATCTGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
S10V6-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-6         GAGGTAGCAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-8         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                **  *** * * ** *  *  *** **    ************ **** ******* *  
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTA---
S13V5-3         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-6         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-4         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-2         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-5         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S13V5-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCGGCAACAATACAAGAAGAAGTATA---
S10V6-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAATAACAATACAAGAAGAAGTATA---
S10V6-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATA---
S10V6-4         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATC---
S10V6-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATA---
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATA---
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATA---
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATA---
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATA---
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                **  *  *****   ** * *** *  * ****   ******* **    ***  *    
S3V6-2          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-4          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-5          ACTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-3          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-6          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S3V6-1          ACTCTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAA
S13V5-3         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-6         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-4         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-2         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-5         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S13V5-1         AATATAGGACCAGGGAGAGCATTTTATGCATCAAGAGGAATAATAGGAGATATAAGACAA
S10V6-2         AATATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-3         AATATGGGACCAGGGAGAGCATTGTATACAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-7         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-6         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
S10V6-8         AATATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-9         AATATGGGACCAGGGAGAGTATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-10        AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-1         AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-4         AATATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S10V6-5         ACTATGGGACCAGGGAGAGCATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
S1V5-2          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          AATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S2V4-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-8          CATATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAA
S2V4-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-2          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAA
S2V4-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S2V4-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                  * *  ******* ***  **  *** *      *      * *   ** ****    *
S3V6-2          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-4          GCACATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-5          GCACATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-3          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S3V6-6          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAA
S3V6-1          GCACATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAA
S13V5-3         GCATATTGTAACATCAGTAAAGCGAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-6         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAA
S13V5-4         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAAGACAGGTAGCTGCAAAA
S13V5-2         GCATATTGTAACATCAGTAAAGCAAAATGGGACAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-5         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S13V5-1         GCATATTGTAACATCAGTAAAGCAAAATGGGATAACACTTTAGGACAGGTAGCTGCAAAA
S10V6-2         GCACATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGCTGTCGACAAA
S10V6-3         GCACATTGTAACATTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-7         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAA
S10V6-6         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-8         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-9         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-10        GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAA
S10V6-1         GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAA
S10V6-4         AGATATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAAGTAGTTGACAAA
S10V6-5         AGATATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGGTGCTGACAAA
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S2V4-3          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-5          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-8          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-1          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S2V4-2          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S2V4-4          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-7          GCACATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-6          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S2V4-9          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                  * ******** * ***  * *     ** *   *******  *      *     ***
S3V6-2          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TTATGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          TTAAGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S13V5-3         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-6         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-4         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-2         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-5         TTAAGAGAACAATTTAAGAATGCTACAATAGTCTTTAATCAATCATCA
S13V5-1         TTAAGAGAACAATTTAGGAATGCTACAATAGTCTTTAATCAATCATCA
S10V6-2         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-3         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-7         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTACTCAATCCTCA
S10V6-6         TTAAGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V6-8         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-9         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-10        TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-1         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-4         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-5         TTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-3          TTAAGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          TTAAGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          TTAAGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          TTAAGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** ** ****  *   ***    ******  *****  ** ** ***


  • Clones from subjects, regardless of visit, generally clustered together
    • Exception of clones from subjects 1 and 2, which show some relationship to one another
      • Clade with both strains present on tree
      • Other clades are clustered by subject
  • The phylogenetic tree suggests that there is no "rapid progression mutation"
    • Subject 1 is a rapid progressor and Subject 2 is a nonprogressor
      • They are closely related on the tree but show different progression rates
    • Had there been a mutation coding for rapid progression on a specific location of the sequence, strains from the final visits of rapid progressors would be closely related to each other and not as closely related to nonprogressors

Research Project Presentation

File:Bioinformatics Presentation 1.pdf

Scientific Conclusion

The purpose of this research project was to find a location or mutation on the env gene of HIV-1 that would differentiate rapid progressors from nonprogressors. Analysis of aligned sequences from the clones of strains from the first and last visits suggest that window 11 could be a favored location for mutations. Phylogenetic analysis suggests that there is no mutation that differentiates strains that cause rapid progression from those that result in nonprogression since strains clustered together by subject rather than progression. Future projects could look at window 11 in more depth, inducing mutations and tracking progression to see if it has an affect.

Acknowledgements

  • My homework partner for the week was Drew Cartmel
    • Drew and I worked together to develop and answer our research question
    • Drew did half of the data collection for the project
    • Drew worked on creating the graph used to present the data
    • We worked together to analyse the data and come to the conclusion we did
  • Kam D. Dahlquist, PhD gave the idea to present the S values in the way that we did
  • This research project was based on and conducted with the results from Markham et al.
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Jmenzago (talk) 23:56, 26 February 2020 (PST)

References

Assignments

Individual Journal Entries

Class Journal Entries