Cdominguez Week 6

From OpenWetWare
Jump to navigationJump to search

user:cdominguez

template:cdominguez

Assignment Page Individual Journal Entries Class Journal
BIOL368/S20:Week 1 user:cdominguez BIOL368/S20:Class Journal Week 1
BIOL368/S20:Week 2 cdominguez Week 2 BIOL368/S20:Class Journal Week 2
BIOL368/S20:Week 3 cdominguez Week 3 BIOL368/S20:Class Journal Week 3
BIOL368/S20:Week 4 cdominguez Week 4 BIOL368/S20:Class Journal Week 4
BIOL368/S20:Week 5 cdominguez Week 5 BIOL368/S20:Class Journal Week 5
BIOL368/S20:Week 6 cdominguez Week 6 BIOL368/S20:Class Journal Week 6
BIOL368/S20:Week 8 cdominguez Week 8 BIOL368/S20:Bibliography
BIOL368/S20:Week 10 cdominguez Week 10 BIOL368/S20:Class Journal Week 10
BIOL368/S20:Week 11 cdominguez Week 11 BIOL368/S20:Class Journal Week 11
BIOL368/S20:Week 13 cdominguez Week 13 BIOL368/S20:Class Journal Week 13
BIOL368/S20:Week 14 cdominguez Week 14 BIOL368/S20:Class Journal Week 14

Purpose

How does the grouping of Subject 7 as a moderate progressor as compared to Subject 7 as a rapid progressor change slope of diversity/divergence as well as compare to rapid progressor phylogenetic trees?

Methods/Results

Regenerating Slope of Divergence/Diversity Graph

  • Opened Excel
  • Subject 7 was moved from moderate progressor to rapid progressor
  • For each type of progressor, took the weighted mean from the given slope of divergence and diversity given in paper
    • This was done by multiplying each subject's slope by the number of observations, adding up all subject's derived slope in the progressor group, and dividing it by total number of observations of all subjects in that specific progressor group
  • The standard error was calculated via excel for each type of progressor group for diversity and divergence
  • The weighted mean and standard error was graphed on excel to match the visual format of the paper's graph for both diversity and divergence
  • The results are shown below:


CdDIVERGENCE.PNG

AnnikaNewDiversityGraph.PNG

Scaled to 0.25

AnnikaDiversityScaled.PNG

Phylogenetic Tree

  • For Subject 1,3, 6, and 16 phylogenetic tree, the following was done:
    • Went to the website www.phylogeny.fr. Scroledl down on the page to the section labeled ‘Phylogeny analysis’, and clicked on the text ‘One Click’
    • Clicked in the large text field labeled ‘Upload your set of sequences in FASTA, EMBL, or NEXUS format’
    • Used Ctrl-V to paste sequences here, then clicked the “Submit” button
    • Clicked on the tab labeled ‘3. Alignment’
    • Clicked on ‘Alignment in Clustal format’
    • Copied and pasted this entire alignment into individual wiki as well as pasted the image of the tree

Subject 1

Phylogenetic Tree

CDphylo treesub1.png

Sequence Alignment CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S1V5-2          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-5          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-1          GAGGTAGTAGTTAGATCCGAAAATTTCACAAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-13         GAGGTAGTAGTTAGGTCTGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V1-13         GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-12         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-11         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-14         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-15         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAGATCATAATAGTACAGCTG
S1V2-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-13         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V2-16         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V2-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAGTCATAATAGTACAGCTG
S1V5-8          GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-10         GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S1V5-11         GAGGTAGTAGTTAGATCCGAAAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTG
S1V5-3          GAGGTAGTAATTAGATCCGAAAATATCGCGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-4          GAGGTAGTAATTAGATCTGAAAATATCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-6          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-9          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
S1V5-7          GAGGTAGTAATTAGATCTGAAAATATCATGAACAATGCTAAAATCATAATAGTACAGCTG
                ********* **** ** *  *** **    **********   ************ ***
S1V5-2          AATAAATCTGTAAACATTAGTTGTATAAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-5          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V5-1          AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-12         AATAAACCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAG---AAGTATA---
S1V5-13         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATACAAGAAGAAGTATA---
S1V1-13         AATACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-6          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACGAGAAAAAGTATA---
S1V2-11         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATA---
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-12         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-10         GATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-10         AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-1          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-14         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-15         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-4          AATAAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-13         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-16         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V2-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATA---
S1V5-8          AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-10         AATGAATCTGTAGGAATTAATTGTACAAGACCCAACAACAATATAAAAAAAAGAATAATA
S1V5-11         AATAAATCTGTAAACATTAGTTGTATGAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-3          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATA
S1V5-4          AATGAATCTGTAGCAATTAGTTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-6          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-9          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
S1V5-7          AATGAATCTGTAGCAATTAATTGTACAAGACCCAACAACAATATAAAACAAAGAATAATG
                 **  * ** **   ****  ****  ****************  *    *** ***   

S1V5-2          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACCA
S1V5-5          AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
S1V5-1          AATATAGGACCAGGTAGAGCATTTTATACAACAGAAGACATAATAGGAGATATAAAACCA
S1V5-12         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-13         AATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-11         CATATAGGACCAGGTAGGGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-5          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-2          CATATAAGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAA
S1V1-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-6          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-10         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-12         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAG
S1V1-11         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-9          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-7          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V1-1          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-14         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-15         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-4          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-8          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-13         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-16         CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V2-2          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V2-3          CATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
S1V5-8          CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-10         CATATAGGACCAGGTAGAGCATTTTATACAA---GAGAC---AAAGGAGATATAAGACAA
S1V5-11         CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-3          CATATAGGACCAGGTAGACCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAA
S1V5-4          CATATAAGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGAAGATATAAGACAA
S1V5-6          CATATAGGACCAGGTAGAGCATTTTATACCA---AAGACATAACAGGGGATATAAGACAA
S1V5-9          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
S1V5-7          CATATAGGACCAGGTAGAGCATTTTATACAA---AAGACATAACAGGGGATATAAGACAA
                 ***** **********  ********** *    ***    * *   ******* **   
S1V5-2          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-5          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-1          GCACATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAAATAGTTATGAAA
S1V5-12         GCACATTGTAACATTAGTGGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-13         GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAAGAGATAGTTATGAAA
S1V1-13         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-4          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACCTTAAAACACATAGTTATAAAA
S1V2-6          GCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-11         GCACATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGCTATAAAA
S1V1-5          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAA
S1V2-5          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACGCTTTAAAACAGATAGTTATAAAA
S1V1-2          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-10         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGGTATAAAA
S1V1-6          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAA
S1V2-10         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-7          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-8          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-9          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-12         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V1-11         GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAATCAGATAGTTATAAAA
S1V1-3          GCATATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAA
S1V2-9          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-7          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-1          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V1-1          GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-14         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-15         GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-4          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-8          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-13         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-16         GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAGAACAGATAGTTATAAAA
S1V2-2          GCTCATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V2-3          GCACATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
S1V5-8          GCATATTGTAACATTAGTAGAGCAGACTGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-10         GCATATTGTAACATTAGTAGAGCAGCACGGAATAACACTTTAAAACGGATAGTTAAAAAA
S1V5-11         GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-3          GCACATTGTAACATTAGTGGAGCAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-4          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-6          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-9          GCATATTGTAACATTAGTAGAACAGCATGGAATAACACTTTAAAACAGATAGTTAAAAAA
S1V5-7          GCATATTGTAACATTAGTAGAGCAGCATGGGATAACACTTTAAAACGGATAGTTAAAAAA
                **  ************** ** **    ** ***** * ***      **** **  ***
S1V5-2          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-5          TTAGGAGAACACTTGGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-1          TTAGGAAAACACTTGAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-12         TTAGGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-13         TTAGGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-13         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-4          TTAAGAGAACACTTTGGCAACAAAACAATAGTCTTTAATCACTCTTCA
S1V2-6          TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCATTCCTCA
S1V2-11         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-5          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-5          TTAAGAGAACGCTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-12         TTAAGAGAACACTTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-2          TTAAGAGAACACTTTAGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-6          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-10         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-8          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-9          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-12         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-11         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-9          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-7          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-1          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCTTCA
S1V2-14         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-15         TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-4          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-8          TTAGGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-13         TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-16         TTAAAAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-2          TTAAAAGAACAACTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V2-3          TTAAGAGAACAATTTGAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-8          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAACCACTCCTCA
S1V5-10         TTAGGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-11         TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-3          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-4          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-6          TTAAGAGAACACTTTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-9          TTAAGAGAACACATTGTGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V5-7          TTAAGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
                ***  * ***   *    ** ***************** ** ** ***

Subject 3

Phylogenetic Tree

CDphylo treesub3.png

Sequence Alignment

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ********************************** *** ************** ******  
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ******** **** ****** ** ** * *************** ***** ********* 
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA 
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                 ****************** *******  ****** *********

Subject 6

Phylogenetic tree

CDphylo treesub6.png

Sequence Alignment CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S6V9-9          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V9-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-2          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-4          GAAGAAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V9-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAAACATAATAGTGCATCTG
S6V5-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-6          GAAATAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-9          GATATAGTAATTAGATCCGCCAGTCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-4          GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-12         GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-5          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-1          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-6          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCCAAAATCATAATAGTGCATCTG
S6V4-10         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-3          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-5          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-7          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-8          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-11         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-2          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-7          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V3-7          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAGAATCATAATAGTGCATCTG
S6V3-1          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCGTAATAGTGCATCTG
S6V3-3          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-8          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-6          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-6          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-4          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-5          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-6          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-9          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTACATCTG
S6V7-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
                **   ************** ** ** * *  ***** * * ** * ******* **** *
S6V9-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-2          AATGAATCTGTAGAAATGAATTGTACAAGGCCCAACAACAATACAAGAAGAGGTATACAT
S6V7-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-8          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-6          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V4-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-12         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-10         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACGACAATACAAGAAGAGGTATACAT
S6V4-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-7          GATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-11         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-9          AATGAACTTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-5          AATGAACATGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAGCAATACAAGAAAAGGTATACAT
S6V7-7          AATAAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-6          AATGAATCTGTAGAAATGAATTGTACAAGACCTAACAACAATACAAGAAAAGGTATACAT
S6V7-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
                 ** **  ***** *** *********** ** ***  *********** **********
S6V9-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V9-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGTATAATAGGAAATATAAGACAAGCA
S6V7-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCC
S6V5-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V7-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V5-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V9-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V9-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-12         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V9-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V4-1          ATAGGACCTGGCAGAGCATTTTATGCAACAGGAGAAGTAATAGGAAATATAAGACAAGCA
S6V4-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATGATAGGAAATATAAGACAAGCA
S6V4-10         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-11         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGACAAGCA
S6V9-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V5-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACTAGCA
S6V3-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGACATAAGACAAGCA
S6V3-8          ATAGGACCAGGCAGAGCATTTTATGCAGCAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V3-9          ATAGGGCCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA 
S6V9-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V7-7          ATAGGACCAGGCAGAGCATTTTATACAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-5          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-9          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGAAAATATAAGACAAGCA
S6V7-3          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
                ***** ** *************** ** ** **    * **** * * ******* *** 
S6V9-9          CATTGTAACCTTAGTAGAACACAATGGAATGACCATTTAAAAAGGGTAGCTATAAAATTA
S6V9-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-8          CATTGTAACCTTAGTAGAGCACAGTGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-4          CATTGCAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-4          CATTGTAACCTTAGTAGAGAACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-8          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V5-8          CATTGTAACCTTCGTAGAGCACAATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V9-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-4          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTCTAAAAAGGGTAGCTATAAAATTA
S6V4-4          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-12         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-10         CATTGTAACCTTAGTAGAGCACAATTGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-11         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-9          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-7          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-3          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACCATTTAAAAAGGAAAGCTATAAAATTA
S6V5-5          CATTGTAACCTTAGTAGAGAACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V2-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACATTTTAAAAAGGATAGCTATAAAATTA
S6V3-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA 
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-6          CATTGTAACCTTAGTAGAGGACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V9-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-4          CATTGTAACCTTAGTAGAGCACGATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-5          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-6          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-9          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
                ***** ****** *****  **  * *****    * ********  *************
S6V9-9          AGAGAACAATTTAAAGCTAATACAATAGTCTTTAATCAATCCTCA
S6V9-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCTATCCTCA
S6V7-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTATTCAATCCTCA
S6V7-2          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-1          GGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-6          AGAGAACAATTTAAGACTAAAACAATAGTCTTTAATCAATCCTCA
S6V9-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-4          AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCAATCCTCA
S6V4-12         AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCATTCCTCA
S6V9-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-10         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-3          AGAGAACAATCTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-5          AGAGAACAATTTAAGAATAAAACAGTAGTCTTTAATCAATCCTCA
S6V4-7          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-8          AGAGAACAATTTAGGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-11         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCATTCCTCA
S6V4-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-7          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-3          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-3          AGAGAACAATTTAAGATAAAAACAATAGTCTTTAATCAATCCTCA
S6V2-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-7          AGAGAACAATTTAAGAATAAAGCAATAGTCTTTAATCAATCCTCA
S6V3-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-8          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCTATCCTCA
S6V3-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTCCTCAATCCTCA
S6V7-5          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-6          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-9          AGAGAACAATTTAAAAATAAAACAATAGTCTTTATTCAATCCTCA
S6V7-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTACTCAATCCTCA
                 *****  ** **      *  ** *** ****   *  ******

Subject 15

Phylogenetic Tree

CDphylo treesub15.png

Sequence Alignment

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S15V2-5         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-3         GAGGTAGTAATTAGATCTGCAAATTTGACGGACAATGCTAAAATCATAATAGTACAGCTG
S15V1-2         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-2         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-4         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-12        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-10        GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-6         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-4         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V4-10        GAGGTAGTAATTAGATCTGTAAAATTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-8         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-2         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-1         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-11        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-9         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V2-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V3-2         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-4         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-1         GAGGCAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-1         GAGGCAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-7         GAGGTAGTAATTAGATCTAAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-8         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-4         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
                * ** *************  *** *  *** ********** ************** *** 
S15V2-5         AATGAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-3         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT 
S15V1-2         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-8         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACCT
S15V2-2         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACCT
S15V2-4         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S15V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-12        AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-10        AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V1-5         AATAAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-6         AAGGAAGTTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-4         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-7         AAGAAAGCTGTAAGAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V4-10        AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGGATACAT
S15V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGGATACAT
S15V3-9         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGAATACCT
S15V1-11        AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V2-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-8         AAGGAATCTGTAGTAATTAATTGTACAAGACCCGACAACAATACAAGAAGAAGGATACCT
S15V2-9         AATGAATCTGTAAGAATTAATTGTACAAGACCCGACAACAATACAAGAAGAAGGATACCT
S15V1-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V2-7         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V3-2         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-4         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V3-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-5         AATGAATCTGTAGAAATTAATTGTACAAGACCCAGCAACAATACAAGAAGAAAGATACCT
S15V3-3         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-7         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
                **  **  ****  *** ******* *******  *** ************   **** *
S15V2-5         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-3         ATAGGACCAGGGAAAGCATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-2         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-8         ATGGGACCAGGGAAAGCATTTTA---TACAGGAGAGATAATAGGAGATATAAGGCAAGCA
S15V2-2         ATAGGACCAGGGAAAGCATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V2-4         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-3         ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-12        ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-9         ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-10        ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-5         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-6         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-4         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-7         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-10        ATAGGACCAGGGAAAACATTTTA---TACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S15V4-6         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-9         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V3-9         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-7         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-8         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-5         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-2         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-1         ATAGGACCAGGGAACGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-11        ATAGGACCAGGGAACGCATTTTA---TACGACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-6         ATAGGACCAGGGAGCGCATTTTATACTACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V2-8         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-9         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-1         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-7         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-2         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-4         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-1         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-1         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-5         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-3         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-6         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V3-7         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V3-8         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V4-3         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-4         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
                ** **********   *******   ***   **  ********* **************
S15V2-5         CATTGTAACATTAGTAGTTCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-3         CATTGTAACATTAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-2         CATTGTAACATTAGTAGATCAAATTGGAATAGCACTTTAAAACAGATAGTTAACAAATTA
S15V1-8         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTA
S15V2-2         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGAGAACAAATTA
S15V2-4         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGAGAACAAATTA
S15V1-3         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-12        CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-9         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-10        CATTGTAACATTAGTGGATCAAAATGGAATAGCACTTTAAAACAGATAGTTAACAAATTA
S15V1-5         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-6         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAATTTA
S15V1-4         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-7         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-10        CATTGTAACATTAGGGGTTCAAAATGTAATAACACTTTAAAACAGACAGTTAACAAATTA
S15V4-6         CATTGTAACATTAGTGAGTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-9         CATTGTAACATTAGGGGTTCAAAATGTAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-9         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-5         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-2         CATTGTAACATTAGTACTCGAATGTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-1         CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-11        CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-6         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTA
S15V2-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGAGAACAAATTA
S15V2-9         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-1         CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-2         CATTGTAACATTAGTATTACAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-4         CATTGTAACATTAGTATTACAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-1         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-1         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-5         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-3         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-6         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-3         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-4         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
                ********** ***      *   ** ***  ************** **  ***** ***
S15V2-5         CTAGAACAATTTGTGAATAAACACATAGTCTTTAATCAATCCTCA
S15V2-3         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAGTCCTCA
S15V1-2         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-8         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V2-2         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V2-4         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V1-3         CGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-12        AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V1-9         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-10        AGAGAACAATTTGTGAATAAACCAATAATCTTTAATCAATCCTCA
S15V1-5         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-6         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAACCAATCCTCA
S15V1-4         AGGGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V1-7         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-10        AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCATTCCTCA
S15V4-6         ACAGAACAATTGGAGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-9         AGAGAACAATTTGGGAATAAAACAATAATCGTTAATCAATCCTCA
S15V3-9         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-7         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V4-8         AGAGAACAATTTGGGAATAAAACAATAATATTTAATCAATCCTCA
S15V4-5         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-2         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-1         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-11        AGAGAACAATTTGTGAATAAAACAATAGTATTTAATCAATCCTCA
S15V2-6         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-8         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-9         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V1-1         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-7         AGAGAAACATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-2         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCTATCCTCA
S15V3-4         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-1         AGAGAACAATTTGGGATTAAAACAATAATATTTAATCAATCCTCA
S15V4-1         AGAGAACAATTTGGGATTAAAACAATAATATTTAATCAATCCTCA
S15V3-5         AGAGAACAATTTGGGAATAAAACAATAATGTTTAATCAATCCTCA
S15V3-3         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-6         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCTATCCTCA
S15V3-7         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-8         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-3         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAGTCCTCA
S15V4-4         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAGTCCTCA
                   ***  *** * ** ****   *** *  **** *  ******

Subject 7

Sequence Alignment

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S7V5-5          GAGATAGTAATTAGATCTGCCGATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-4          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-6          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAGACCATAATAGTACAGCTG
S7V4-3          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-1          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-2          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-6          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-10         GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-2          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S7V2-3          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-4          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V1-9          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-5          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTA
S7V2-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-1          GAGATAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-7          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAAACCATAATAGTACAGCTG
S7V2-5          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATACTAAAACCATAATAGTACAGCTG
S7V1-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V1-8          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAAACCATAATAGTACAGCTG
S7V5-2          GAGATAGTAATTAGATCTGCCGATTTCTCGGACAATGCTAAGACCATAATAGTACAACTG
S7V3-6          GAGGTAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V5-4          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-8          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-9          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-3          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAACTG
S7V5-6          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-1          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V5-7          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V4-8          GAGATAGTAATTAGATCTGCCAATCCTACGGACAATACTAAGACCATAATAGTACAGCTG
S7V3-2          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V3-7          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-4          GAGGTAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V3-5          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-3          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-8          GAGATAGTAATTAGATCTGCCTATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V3-1          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCCAAGACCATAATAGTACAGCTG
S7V2-4          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V2-2          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V2-6          GAGATAGTAATTAGATCTGCCAATCTCACGGACAATGCCAAGACCATAATAGTACAGCTG
S7V4-5          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAAACCATAATAGTACAGCTG
S7V4-7          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V2-7          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
S7V4-9          GAGATAGTAATTAGATCTGCCAATCTCTCGGACAATGCTAAGACCATAATAGTACAGCTG
                *** ***************** **    ******** * ** ************** **  
S7V5-5          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-4          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-6          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-3          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-1          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V4-2          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-6          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-10         AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-2          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACTT
S7V2-3          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-4          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-9          AGTGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-5          AATGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATATCT
S7V2-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCGACAACAATACAAGAAAAAGTATACCT
S7V1-1          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-7          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V2-5          AAAGCACCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAAGGAAAAGTATATCT
S7V1-3          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V1-8          AATGCACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-2          AATGCATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-6          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-4          AATGCATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-8          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGGAAAGTATATCT 
S7V5-9          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-3          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-6          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V5-1          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAGTACAAGGAAAAGTATATCT
S7V5-7          AAAGTACCTATAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-8          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-2          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAGAAGCATATCT
S7V3-7          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAATAACAATACAAGGAAAAGTATATCT
S7V3-4          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-5          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-3          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATACCT
S7V3-8          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V3-1          AAAGTATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-4          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-2          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-6          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-5          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-7          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V2-7          AAAGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
S7V4-9          AATGTACCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGGAAAAGTATATCT
                *  * * ** **************** ****** * **** ******   *** ***  *

S7V5-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V4-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAGATATAAGACAAGCA
S7V1-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-10         ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGGAATATAAGACAAGCA
S7V1-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAGTAGGAAATATAAGACAAGCA
S7V5-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V3-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V5-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V5-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S7V4-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-3          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-8          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V3-1          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-4          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-2          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-5          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V2-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V4-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
                *************************************** ****  ******* ****** 
S7V5-5          CATTGTACAGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAGTTA
S7V4-4          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-6          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-3          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-1          CATTGTAACGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-2          CATTGTACCGTAAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-6          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-10         CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-3          CATTGTAACGCTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-4          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-9          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAGCAGATGGCTACAAAATTA
S7V1-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-7          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V2-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-3          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V1-8          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S7V5-2          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAGTTA
S7V3-6          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGCAACGAAATTA
S7V5-4          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-8          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-9          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-6          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-1          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V5-7          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-8          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-2          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-4          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-5          CATTGTAACATTAGTAGGACAAAATGGAGTAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-3          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-8          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V3-1          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-4          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-2          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-6          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-5          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V2-7          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V4-9          CATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
                *******     * ***   ******** ************ ***** *  ** ** ***
S7V5-5          AGAGAAAAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-4          AGAGAACAATTTAGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-6          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-3          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-1          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-2          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-6          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-10         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-2          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V2-3          AGAAAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-4          AGAAACCAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-9          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V1-1          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-7          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-8          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-2          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V3-6          AGAGAACAATTTGAGAATAAAACAATAATCTTTAAGCAATCCTCA
S7V5-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-9          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V5-3          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-6          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-1          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V5-7          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V4-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCATCA
S7V3-2          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-7          AGAGAAAAATTTGAGAATAAAACAATAATCTTTAAGCAATCCTCA
S7V3-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-5          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-3          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-8          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V3-1          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-4          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-2          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-6          AGAGAAAGATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-5          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-7          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V2-7          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V4-9          AGAGAAAAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
                *** *   ****  ************* ******* ***** ***

Subject 4

Phylogenetic Tree

AnnikaSubject4Tree.png


Sequence Alignment

'Clustal Sequence

S4V2-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-16         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-17         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-14         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-18         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-8          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-2          GAGGTTGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-5          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-9          GAGGTAGTAATTAGATCTGAAAAGGTCACGAACGATGCTAAAATTATAATAGTACAGCTG
S4V3-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V1-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-6          GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-11         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-12         GAGGTAGTAATTAGATCTGAAAATTTCACTAACAATGCTAAAATTATAATAGTACAGCTG
S4V4-9          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-15         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-6          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-12         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-12         GAGGTAGTAGTTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAACAGTACAGCTG
S4V2-13         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-10         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-8          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V3-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S4V2-4          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
                ***** *** *************  **** *** *************** **********
S4V2-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACCT
S4V4-4          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V3-16         AATAAATCTGTAGGAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V4-13         AATGAATCTGTAGAAATTAATTGTACAAGACCTGACAACCATACAGTAAGAAAGATACCT
S4V3-17         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAGTATACCT
S4V2-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACGAAGAAGTATACCT
S4V3-14         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACAT
S4V3-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-10         AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-13         AATGAATCTATAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V3-18         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACACTAAGAAGTATACCT
S4V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACACGACAACAATACAGTAAGAAAGATACCT
S4V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V1-3          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-1          AATAAATCTGTAGAAATCAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V4-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-7          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAATAAGAAGGATACCT
S4V2-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V1-2          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V2-5          AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCT
S4V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAAAAAGATACCT
S4V3-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAAGATACCT
S4V4-1          AATAAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACAATACAGTAAGAAAGATACCT
S4V4-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-11         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-15         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
S4V3-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V3-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACTACCATACAGTAAGAAAGATACCT
S4V2-12         AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACCATACAGTAAGAAAGATACCT
S4V2-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-13         AATGAATCGGTAGAAATTAATTGTACAAGACCCAACAACCATACAATAAGAAAGATACCT
S4V2-10         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAGTAAGAAGGATACCT
S4V2-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V3-7          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATACCT
S4V2-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACACCAATACAGTAAGAAAGATACCT
S4V2-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCGACAACAATACAGTAAGAAAGATACCT
                *** ****  *** *** *************   **  * *****  ** **  **** *
S4V2-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAAAAAATATAAGGCAAGCACAT
S4V4-4          ATAGGACCCGGCAGAGCATTTTATACAACAGGCAGAATAGGCAATATAAGGCAAGCTCAT
S4V3-16         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGCGATATAAGGCAAGCACAT
S4V4-13         ATAGGACTAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V3-17         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGACATAAGGCAAGCACAT
S4V2-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-14         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V3-18         ATAGGACCAGGGAGAGCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V4-8          ATAGGACCAGGGAGTTCATTTTATACAACAGGCATAATAGGAGATATAAGGCAAGCACAT
S4V4-2          ATAGGACCAGGGAGATCATTTTATACAACAGGCATAGTAGGAGATATAAGGCAAGCACAT
S4V3-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-9          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-11         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGTAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-5          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGACATAAGGCAAGCACAT
S4V4-10         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCTCAT
S4V1-3          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V1-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACAT
S4V4-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAAATATAAGGCAAGCACAT
S4V2-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-11         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V1-2          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-5          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-2          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V3-3          ATAGGACCAGGGAGTTCATTTTATACAACAGGCGTAATAGGAGATATAAGGCAAGCACAT
S4V4-1          ATAGGACCCGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-4          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-6          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V4-11         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-12         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V4-9          ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAGTAGGAGATATAAGGCAAGCACAT
S4V3-1          ATAGGACCAGGGAGTTCATCTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-15         ATAGGACCAGGGAGTTCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-6          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-12         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-1          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-13         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-10         ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-3          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-8          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V3-7          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-2          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
S4V2-4          ATAGGACCAGGGAGAGCATTTTATACAACAGGCAGAATAGGAGATATAAGGCAAGCACAT
                *******  ** **  *** ************   * **    * ******* *** ***
S4V2-6          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAAA
S4V4-4          TGTAACATTATTGAAGCAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-16         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGTTAACAAATTAAGA
S4V4-13         TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-17         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-14         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-18         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-8          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-2          TGTAACATTAGTAAAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATGGCTAACAAATTAAGA
S4V3-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-11         TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-5          TGTAACATTAGTAAAACAAAACGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V1-3          TGTAACATTAGTAGAACAAAATGGAATAACGCTTTAAAACTGATAGTTAACAAATTAAGA
S4V1-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-11         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGG
S4V1-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-5          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V3-4          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V4-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTAATAGTTAACAAATTAAGA
S4V4-11         TGTAACATTAGTAGAACAAAATGGAACAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V4-9          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-15         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-6          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V3-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGCTAACAAATTAAGA
S4V2-12         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-1          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-13         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-10         TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-3          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-8          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V3-7          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-2          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
S4V2-4          TGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAATTAAGA
                ********** *  * ***** **** *** ********** ** * ***********  
S4V2-6          AAACAATTTAAAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-4          GAACAGTTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-16         GAACAATTTAGGAATAAAACAATAATCTTTAGTCAATCCCCA
S4V4-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-17         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-14         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-8          GAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S4V3-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-13         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-18         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-8          GAACAATTTAGAAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-5          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-11         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-5          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-10         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-1          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-11         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V1-2          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-5          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-2          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-3          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-1          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-4          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-11         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V4-9          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-1          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-15         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-6          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-12         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-12         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-1          GAACAATTTAGGAATGAAACAATAATCTTTAATCAATCCTCA
S4V2-13         GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-10         GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-3          GAACAATTTAGGAATAAAACAATAATCTTTAATCAA-CCTCA
S4V2-8          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V3-7          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-2          GAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S4V2-4          GAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
                 **** ***   *** ******** ****** **** ** **

Subject 10

Phylogenetic Tree

AnnikaSubject10Tree.png

Sequence Alignment

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S10V6-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V5-3         GAGGTAGTAATAAGATCTAAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-8         GAGGTAGTAATTAGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-15        GAGGTAGTAATTAGATCTGAAGATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAA---ATAATAGTACAGCTG
S10V4-11        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-12        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-13        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-5         GAGGTAGTAATAAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-6         GAGGTAGTAATAAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-8         GAGGTAGTAATCAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V5-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-14        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-16        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTATAGCTG
S10V6-6         GAGGTAGCAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-9         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V2-2         GAGATAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V6-8         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V4-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V2-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S10V1-2         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG 
S10V1-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAATACAGCTG
S10V1-6         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V2-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V4-10        GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V6-4         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
S10V6-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
                *** *** *** ****** ** * ******************   ****** ** * ***
S10V6-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAATAACAATACAAGAAGAAGTATAAAT
S10V5-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAAAATAAGT
S10V4-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-15        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-4         AATAAAGCTGTAGAAATCAATTGCACAAGACCCAACAACAATAAAAAAAGAAGAATAAGT
S10V4-11        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAGCAACAATACAAGAAGAAGTATAAAT
S10V5-9         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAGCAATACAAGAAGAAGAATAAGT
S10V5-10        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGACGAAGAATAAGT
S10V4-3         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-12        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V4-13        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V5-2         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V5-5         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAGAAGAATAAGT
S10V5-6         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAGAAGAATAAGT
S10V5-8         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAGAAGAAGAAGAATAAGT
S10V4-6         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAACACAAGAAGAAGAATAAGT
S10V4-1         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V5-1         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-2         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V4-14        AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGAATAAGT
S10V6-7         AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-5         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGCATACAT
S10V4-16        AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT 
S10V4-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-9         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-8         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACGAGAAGAAGTATAAAT
S10V2-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-2         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-4         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-6         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-1         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V2-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V4-10        AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V6-4         AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATCAAT
S10V6-5         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAAAAGAATAACT
                *** ** ********** *** ************  * *** *  * *  **  **   *
S10V6-2         ATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V5-3         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATATTAGGAGATATAAGGCAAGCA
S10V4-8         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-15        ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-4         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-11        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-7         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-9         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-10        ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-3         ATGGGACCAGGGAGAGTACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-12        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATGATAGGAGATATAAGGCAAGCA
S10V4-13        ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-2         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGAAAGCA
S10V5-5         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-6         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V5-8         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-6         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-1         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCGAGCA
S10V5-1         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCGAGCA
S10V4-2         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-14        ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-7         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V4-5         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-16        ATGGGACCAGGGAGAGCATTCTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-6         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V4-9         ATGGGACCAGGGAGAGCATTCTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V6-3         ATGGGACCAGGGAGAGCATTGTATACAACAGGAGACATAATAGGAGATATAAGGCAAGCA
S10V6-9         ATGGGACCAGGGAGAGTATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-10        ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-1         ATGGGACCAGGGAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-2         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V6-8         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-4         ATGGGACCAGGGAGAGTATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-1         ATGGGACCAGGGAGAGCACTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAGTAATAGGAGATATAAGGCAAGCA
S10V2-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-2         ATGGGACCAGGGAGAGCATTATATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-4         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-6         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGGAATAATAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-1         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V2-5         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V4-10        ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAGTAGGAGATATAAGGCAAGCA
S10V6-4         ATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAAGA
S10V6-5         ATGGGACCAGGGAGAGCATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAAAGA
                ***** ********** * * *** *********   *   *************  *  *
S10V6-2         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGCTGTCGACAAATTA
S10V5-3         CATCGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-8         CACTGTAGCCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA
S10V4-15        CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA 
S10V5-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V4-11        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAGGTTA
S10V5-7         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-9         CATTGTAACCTTAGTTGAACGAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-10        CATTGTAACCTTAGTTGAACGAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-3         CATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-12        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-13        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V5-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGCTGACAAATTA
S10V5-8         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGCTGACAAATTA
S10V4-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V5-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAATTA
S10V4-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-14        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAGAACAGGTAGTTGACAAATTA
S10V6-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAATTA
S10V4-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-16        CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAGTTA
S10V6-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAAGTAGTTGACAAATTA
S10V4-9         CATTGTAACCTTAGTAGAACAAAATGGCATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-3         CATTGTAACATTAGTAGAACAGAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-9         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAATTA
S10V6-10        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGCCAAATTA 
S10V2-2         CATTGTAACCTTAGTAGAACAAAATGGAACGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-8         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACGAATTA
S10V2-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-6         CATTGAAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-2         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-4         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-6         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-1         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V2-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V4-10        CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V6-4         TATTGTAACCTTAGTAGAACAGAATGGAATGACACTTTAAAACAAGTAGTTGACAAATTA
S10V6-5         TATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGGTGCTGACAAATTA
                 *  * * * ***** ****  ***** * ********* **** *  *    *   *** 
S10V6-2         AGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V5-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-15        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-11        AGAGAACAATTTAGGAATAAAGCAATAATCGTTAATCAATCCTCA
S10V5-7         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-9         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-3         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-12        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-13        AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-5         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA 
S10V5-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-6         AGGGAACAATTTAGGAATAAAACAATAATCCTTAATCAATCCTCA
S10V4-1         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V5-1         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-14        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA 
S10V6-7         AGAGAACAATTTAGGAACAAAACAATAATCTTTACTCAATCCTCA
S10V4-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAAGCAATCCTCA
S10V4-16        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-6         AGAGAACAATTTAGGAACAAAACAATAATCTTTAATCAATCCTCA
S10V4-9         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-9         AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V6-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTACTCAATCCTCA
S10V2-2         AGAGAGCAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-8         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-4         AGGGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-2         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-6         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-1         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V2-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA 
S10V4-7         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V4-10        AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-4         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V6-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
                 * ** *********** *** ******** ***  *********


Subject 11

Phylogenetic Tree

AnnikaSubject11Tree.png

Sequence Alignment CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S11V1-4         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAATAATGCTAAAAACATAATAGTACAGCTG
S11V3-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-7         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-1         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-10        GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-6         GAGGTAATAATTAGGTCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ************** *** ************* ***************************
S11V1-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACCAAGGATAATA
S11V3-5         AATAAATCTGTAGTAATTAATTGTACAAGACCCGATAACACTATAAAACAAAGGATAATA
S11V1-2         AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA
S11V4-2         AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V1-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-10        AATGAATCTGTAGTAATTAATTGTACGAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-8         AATGAATCTGTAGTAATTAATTGTACCAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-3         AATGGATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-4         AATGAATCTGTAGTGATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
                ***  ********* **** **** * ********  ******* **** **********
S11V1-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-5         CATATAGGACCAGGGAGACCATTCTATACAACAGAAATAAAAGGAAATATAAGACAAGCA
S11V1-2         CATATAGGACCAGGGAGACCATTCTATACGACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-9         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V4-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-10        CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-5         CATATAGGACCAGGGAGACCATTCTATACAACAAGAATAAAAGGAAATATAAGACAAGCA
S11V2-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-6         CATGTAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-9         CATATAGGACCAGGGAGACCATTCTATACAGCAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                *** *************************  **  ********** **************
S11V1-4         CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-8         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAACTTA
S11V3-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA 
S11V3-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-2         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA
S11V4-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTAAGAAAATTA
S11V4-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V1-7         CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V3-10        CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-8         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA
S11V1-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-3         CATTGTAACGTTAGTAGAGGACAATGGAATAGAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
                ***************   ********* *** ******************   **  ***
S11V1-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-5         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA 
S11V1-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-2         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-6         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-5         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-1         AGAGAACAATATGGACTGAACAAAACAATAGTCTTTAAGCAACCCATA
S11V4-9         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-1         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-4         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-1         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-3         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-10        AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA 
S11V1-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-1         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-9         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-7         AGAGAACAATATGGACTGAATAAAACAATAGCCTTTAAGCAACCCATA
S11V1-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
                ************** *  ** ********** ****************

Theta Results

  • Calculated theta for the following subjects organized in the table below:
Table 1
Subject Number of Clones S Theta
3 39 42 9.88
6 54 71 14.67
15 40 75 15.31
1 42 90 4.33
4 47 63 14.12
10 49 74 16.52
11 31 35 8.7
7 43 55 12.64

Data and Files

File:HIV DATAEXCEL CD.zip

Media:CdDIVERGENCE.PNG

Media:CDphylo treesub1.png

Media:CDphylo treesub3.png

Media:CDphylo treesub6.png

Media:CDphylo treesub15.png

Media:AnnikaSubject4Tree.png

Media:AnnikaSubject10Tree.png

Media:AnnikaSubject11Tree.png

Media:AnnikaNewDiversityGraph.PNG

Media:AnnikaDiversityScaled.PNG

Presentation

As PDF:

Media:CDADPresentation_.pdf

Conclusion

We hypothesized that changing Subject 7 to a rapid progressor would increase signficance between moderate and rapid progressor group slope of diversity and divergence. However, it did not change significance between progressor groups and resulted in a similar graph with bigger error bars. We also hypothesized that Subject 7's phylogenetic tree would more closely resemble rapid progressor phylogenetic trees as opposed to moderate progreessor phylogenetic trees. The phylogentic tree of Subject 15 and Subject 7 did look similar; however, not all rapid trees had the same pattern of evolution. In conclusion, moving subject 7 to rapid progressor group did not change the data significance but did show potential for yielding more similar looking trees.

Acknowledgments

  • I worked with User: adinulos for this assignment during class where we analyzed the data together and met outside of class to work on our presentation
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Cdominguez (talk) 15:56, 20 February 2020 (PST)

References

  • Markham, R.B., Wang, W.C., Weisstein, A.E., Wang, Z., Munoz, A., Templeton, A., Margolick, J., Vlahov, D., Quinn, T., Farzadegan, H., & Yu, X.F. (1998). Patterns of HIV-1 evolution in individuals with differing rates of CD4 T cell decline. Proc Natl Acad Sci U S A. 95, 12568-12573. doi: 10.1073/pnas.95.21.12568 (PubMed ID: 9770526)
  • OpenWetWare. (2020). BIOL368/S20:Week 5. Retrieved February 26, 2020, from https://openwetware.org/wiki/BIOL368/S20:Week_5.
  • Phylogeny.fr. (2020) Phylogeny.fr:Home. Retrieved February 20, 2020, from http://www.phylogeny.fr/.