Cdominguez Week 5

From OpenWetWare
Jump to navigationJump to search

user:cdominguez

template:cdominguez

Assignment Page Individual Journal Entries Class Journal
BIOL368/S20:Week 1 user:cdominguez BIOL368/S20:Class Journal Week 1
BIOL368/S20:Week 2 cdominguez Week 2 BIOL368/S20:Class Journal Week 2
BIOL368/S20:Week 3 cdominguez Week 3 BIOL368/S20:Class Journal Week 3
BIOL368/S20:Week 4 cdominguez Week 4 BIOL368/S20:Class Journal Week 4
BIOL368/S20:Week 5 cdominguez Week 5 BIOL368/S20:Class Journal Week 5
BIOL368/S20:Week 6 cdominguez Week 6 BIOL368/S20:Class Journal Week 6
BIOL368/S20:Week 8 cdominguez Week 8 BIOL368/S20:Bibliography
BIOL368/S20:Week 10 cdominguez Week 10 BIOL368/S20:Class Journal Week 10
BIOL368/S20:Week 11 cdominguez Week 11 BIOL368/S20:Class Journal Week 11
BIOL368/S20:Week 13 cdominguez Week 13 BIOL368/S20:Class Journal Week 13
BIOL368/S20:Week 14 cdominguez Week 14 BIOL368/S20:Class Journal Week 14

Purpose

To learn and utilize online tools, such as aligning sequences and creating phylogenetic trees, for analyzing the dataset of the Markham et al. paper in order to critically evaluate the use of data in its results and discussion.

Methods/Results

Activity 1

Part 1:PubMed

  • I found the paper by changing the database search option to "PubMed" and then putting in the title of the paper into the search bar
  • I could have also searched by putting in the title of the paper without specifying the database; however, this gives me many more options and made it more difficult to find the paper I was looking for. There is also a link for PubMed database on the homepage. I could click on that and then search the title of the paper of which I get the result of that one paper.
  • There are side links for similar articles to the HIV paper as well as links to papers that I have cited the article. There are also links available for more information on HIV itself, such as medical websites that describe symptoms and course of disease.

Part 2:GenBank

  • Went to nucleotides on right panel of paper to find GenBank record --> choose GenBank record S4V2-3
  • Accession number: AF089153
  • Subject 4
  • The definition section of full record
  • Downloaded 4 sequences in FASTA format
    • Clicked the "Send to" link in the upper right of the page. Selected "Complete Record", "File" as the Destination, and "FASTA" as the format. Clicked the "Create File" button

Part 3: Introduction to Phylogeny.fr

  • Went to the website www.phylogeny.fr. Scroledl down on the page to the section labeled ‘Phylogeny analysis’, and clicked on the text ‘One Click’
  • Clicked in the large text field labeled ‘Upload your set of sequences in FASTA, EMBL, or NEXUS format’
  • Used Ctrl-V to paste sequences here, then clicked the “Submit” button
  • Clicked on the tab labeled ‘3. Alignment’
  • Clicked on ‘Alignment in Clustal format’
  • Copied and pasted this entire alignment into individual wiki

Alignment in Clustal Format Results

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

AF089521.1      GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
AF089539.1      GAGGTAGTAATTAGATCCAAGAATTTCACGGATAATGCTAAAATCATAATAGTACAGCTA
AF089153.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
AF089493.1      GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACATCTG
                ****** **********  * ****** *  * **********  *********** ** 
AF089521.1      AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA
AF089539.1      AATGAGACTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGT---ATA
AF089153.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAG---ATA
AF089493.1      AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGT---ATA
                *** *  ****** *********  ******** ** **  ** *  *  **     ***
AF089521.1      CATATAGGACCAGGGAGACCATTCTATACAACAGG---AATAAAAGGAAATATAAGACAA
AF089539.1      CCTATAGGACCAGGCAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGACAA
AF089153.2      CCTATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCAA
AF089493.1      AATATGGGACCAGGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGGCAA
                 *** ******** *** **** *** *******    * ** **** ******* ***
AF089521.1      GCACATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAA
AF089539.1      GCACATTGTAACCTTAGTAGAGCAAAATGGAATGAAACTTTAAAACAGATAGTCATAAAA
AF089153.2      GCACATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAA
AF089493.1      GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGCTGTTGCCAAA
                ************ ***** **  * ******** * ****** *** *   **    ***
AF089521.1      TTAAGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
AF089539.1      TTAAAAGAACAATTTAG---GAATAAAACAATAGTCTTTAGTCCATCCTCA
AF089153.2      TTAAGAGAACAATTTAG---GAATAAAACAATAATCTTTAATCAATCCTCA
AF089493.1      TTAAGAGAACAATTTAG---GAACAAAACAATAATCTTTACTCAATCCTCA
                **** ******** * *    ** ********* ******  * * **  *

Phylogenetic Tree

  • Clicked on "6. Tree Rendering"
  • Downloaded image as PNG giving it unique name

CDphylo tree4sequences.png

  • It is not clear where the differences are in the sequence alignment that caused divergence in the phylogenetic tree. It is also difficult to tell this due to it being broken up into different parts. The phylogenetic is a good depiction of the divergences without having to manually look at each nucleotide and assume differences based on that.

Activity 2

Part 1: Looking at clustering across subjects

Table 1
Subject Clone #
1 V1-1
V1-2
V1-3
2 V1-1
V1-2
V1-3
3 V1-1
V1-2
V1-3
5 V1-1
V1-2
V1-3
  • The following generated the phylogenetic tree pictured below:

CDphylo tree12sequences.png

  • Answer to following questions:
    • Yes the clones from all the subject (1,2,3,5) cluster together on the tree.
    • Yes subject 2 and subject 3 clones each branch off from one another as to show more diversity in possible mutations. Subject 2 does not share the same most recent common ancestor with all of its clones and Subject 3 does not share a most recent common ancestor with all of its clones. Subject 5 clones all share a most recent common ancestor and Subject 1 clones also all share a most recent common ancestor.
    • Subject 2 and subject 1 cluster together and diverge with at a point or most recent common ancestor.
    • Subject 3 is the most divergent in potential evolutionary relationships by branching off from all other subject clones. Subject 5 differed from Subject 1 and Subject 2 by two most recent common ancestors but clustered together in all its clones. Subject 2 and 1 are most likely closest in evolutionary relationship due to sharing a most recent common ancestor and branching off at a node.

Part 2: Quantifying diversity within and between subjects

  • Downloaded data from: Nucleotide Sequence Data
  • Selected all clones from each of the following subject
  • Aligned sequences as described above with the following results:

Subject 3

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
                **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
                ********************************** *** ************** ******
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA 
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
                ******** **** ****** ** ** * *************** ***** *********
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
                **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                ****************** *******  ****** *********

Subject 6

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S6V9-9          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V9-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-2          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
S6V7-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-4          GAAGAAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V7-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V5-1          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTGCATCTG
S6V9-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAAACATAATAGTGCATCTG
S6V5-8          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-6          GAAATAGTAATTAGATCCGTCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-4          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-9          GATATAGTAATTAGATCCGCCAGTCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-4          GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-12         GATATAGTAATTAGATCCGCCAATCTCGCGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-5          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-1          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-6          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCCAAAATCATAATAGTGCATCTG
S6V4-10         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-3          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-5          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-7          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-8          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-11         GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V4-2          GATATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-7          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V3-7          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAGAATCATAATAGTGCATCTG
S6V3-1          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCGTAATAGTGCATCTG
S6V3-3          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-8          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-6          GAAGTAGTAATTAGATCCGTCAATCTCACAGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-3          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V1-2          GAAGTAGTAATTAGATCCGCCAATCACACGGACAATGCTAAAATCATAATAGTGCATCAG
S6V5-6          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-9          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-5          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-4          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V2-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V3-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V5-2          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V9-1          GAAGTAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-7          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAAAATCATAATAGTGCATCTG
S6V7-5          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-6          GAAATAGTAATTAGATCCGCCAATCTCACGAACAATGCTAAAATCATAATAGTGCATCTG
S6V7-9          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATGCTAGAACCATAATAGTACATCTG
S6V7-3          GAAATAGTAATTAGATCCGCCAATCTCACGGACAATACTAGAACCATAATAGTGCATCTG
                **   ************** ** ** * *  ***** * * ** * ******* **** *
S6V9-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V7-2          AATGAATCTGTAGAAATGAATTGTACAAGGCCCAACAACAATACAAGAAGAGGTATACAT
S6V7-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-8          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-6          AATGAATCTGTAGGAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V4-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-12         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V9-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-10         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACGACAATACAAGAAGAGGTATACAT
S6V4-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-7          GATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-11         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V4-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S6V1-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-9          AATGAACTTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-5          AATGAACATGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-7          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-8          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V1-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-6          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-4          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V2-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V3-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V5-2          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V9-1          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAGCAATACAAGAAAAGGTATACAT
S6V7-7          AATAAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-5          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-6          AATGAATCTGTAGAAATGAATTGTACAAGACCTAACAACAATACAAGAAAAGGTATACAT
S6V7-9          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
S6V7-3          AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACAT
                ** **  ***** *** *********** ** ***  *********** **********
S6V9-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V9-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGTATAATAGGAAATATAAGACAAGCA
S6V7-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCA
S6V7-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAAATATAAGACAAGCC
S6V5-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V7-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V5-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAGAATAATAGGAGATATAAGACAAGCA
S6V9-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGGAATAATAGGAGATATAAGACAAGCA
S6V9-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-12         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V9-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAAATATAAGACAAGCA
S6V4-1          ATAGGACCTGGCAGAGCATTTTATGCAACAGGAGAAGTAATAGGAAATATAAGACAAGCA
S6V4-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATGATAGGAAATATAAGACAAGCA
S6V4-10         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-8          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-11         ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V4-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V1-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-9          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGATATAATAGGAGATATAAGACAAGCA
S6V9-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V5-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-7          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACTAGCA
S6V3-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGACATAAGACAAGCA
S6V3-8          ATAGGACCAGGCAGAGCATTTTATGCAGCAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-3          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V1-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAAATATAAGACAAGCA
S6V3-9          ATAGGGCCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-5          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-4          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V2-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V3-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V5-2          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V9-1          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAGAAATAATAGGAGATATAAGACAAGCA
S6V7-7          ATAGGACCAGGCAGAGCATTTTATACAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-5          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-6          ATAGGACCAGGCAGAGCATTTTATGCAACAGGAAAAATAATAGGAAATATAAGACAAGCA
S6V7-9          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGAAAATATAAGACAAGCA
S6V7-3          ATAGGACCAGGCAGAGCATTTTATGCAACAAGAAAAATAATAGGAAATATAAGACAAGCA
                ***** ** *************** ** ** **    * **** * * ******* *** 
S6V9-9          CATTGTAACCTTAGTAGAACACAATGGAATGACCATTTAAAAAGGGTAGCTATAAAATTA
S6V9-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-8          CATTGTAACCTTAGTAGAGCACAGTGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-4          CATTGCAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-4          CATTGTAACCTTAGTAGAGAACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-8          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V5-8          CATTGTAACCTTCGTAGAGCACAATGGAATGACACTTTAAAAAGGGGAGCTATAAAATTA
S6V9-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V9-4          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTCTAAAAAGGGTAGCTATAAAATTA
S6V4-4          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-12         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-10         CATTGTAACCTTAGTAGAGCACAATTGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-11         CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V4-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-1          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-9          CATTGTAACCTTAGTAGAGCACAATGGAATGCACATTTAAAAAGGATAGCTATAAAATTA
S6V5-7          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-3          CATTGTAACCTTAGTAGAGCACCATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACCATTTAAAAAGGAAAGCTATAAAATTA
S6V5-5          CATTGTAACCTTAGTAGAGAACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V2-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-7          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACATTTTAAAAAGGATAGCTATAAAATTA
S6V3-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-8          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-6          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-3          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V1-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-6          CATTGTAACCTTAGTAGAGGACAATGGAATGACAGTTTAAAAAGGATAGCTATAAAATTA
S6V9-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-9          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-5          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-4          CATTGTAACCTTAGTAGAGCACGATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V2-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V3-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V5-2          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V9-1          CATTGTAACCTTAGTAGAGCACAATGGAATGACACTTTAAAAAGGATAGCTATAAAATTA
S6V7-7          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-5          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-6          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-9          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
S6V7-3          CATTGTAACCTTAGTAGAACACAATGGAATGACACTTTAAAAAGGGTAGCTATAAAATTA
                ***** ****** *****  **  * *****    * ********  *************
S6V9-9          AGAGAACAATTTAAAGCTAATACAATAGTCTTTAATCAATCCTCA
S6V9-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCTATCCTCA
S6V7-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTATTCAATCCTCA
S6V7-2          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-1          GGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-8          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-6          AGAGAACAATTTAAGACTAAAACAATAGTCTTTAATCAATCCTCA
S6V9-4          AGAGAACAATTTAAAAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-4          AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCAATCCTCA
S6V4-12         AGAGAACAATTTAAGAATGAAACAATAGTCTTTAATCATTCCTCA
S6V9-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-10         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-3          AGAGAACAATCTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-5          AGAGAACAATTTAAGAATAAAACAGTAGTCTTTAATCAATCCTCA
S6V4-7          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-8          AGAGAACAATTTAGGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V4-11         AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCATTCCTCA
S6V4-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-7          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V9-3          AGAGAACAATTTAAGAATAAAACAATAGCCTTTAATCAATCCTCA
S6V5-3          AGAGAACAATTTAAGATAAAAACAATAGTCTTTAATCAATCCTCA
S6V2-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-7          AGAGAACAATTTAAGAATAAAGCAATAGTCTTTAATCAATCCTCA
S6V3-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-8          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-3          AGAGAAGTATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V1-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-6          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCTATCCTCA
S6V3-9          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-5          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAAGCAATCCTCA
S6V3-4          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V2-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V3-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V5-2          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V9-1          AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCA
S6V7-7          AGAGAACAATTTAAAAATAAAACAATAGTCTTTCCTCAATCCTCA
S6V7-5          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-6          AGAGAACAATTTAAAAATAAAACAATAGTCTTTACTCAATCCTCA
S6V7-9          AGAGAACAATTTAAAAATAAAACAATAGTCTTTATTCAATCCTCA
S6V7-3          AGAGAACAATTTAAGAATAAAACAATAGTCTTTACTCAATCCTCA
                *****  ** **      *  ** *** ****   *  ******

Subject 15

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment

S15V2-5         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-3         GAGGTAGTAATTAGATCTGCAAATTTGACGGACAATGCTAAAATCATAATAGTACAGCTG
S15V1-2         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-2         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-4         GAGGTAGTAATTAGATCTGAAAATTGCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-12        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-10        GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V1-6         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-4         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V4-10        GAGGTAGTAATTAGATCTGTAAAATTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-9         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-8         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-2         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-1         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-11        GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V2-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V2-9         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-1         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAGATCATAATAGTACATCTG
S15V2-7         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V3-2         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-4         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-1         GAGGCAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-1         GAGGCAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-5         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-6         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-7         GAGGTAGTAATTAGATCTAAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V3-8         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-3         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
S15V4-4         GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACATCTG
                * ** *************  *** *  *** ********** ************** ***
S15V2-5         AATGAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-3         AATGAATCTGTAGAAATGAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-2         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-8         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACCT
S15V2-2         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACCT
S15V2-4         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGTATACAT
S15V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-12        AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
S15V1-10        AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V1-5         AATAAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-6         AAGGAAGTTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-4         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-7         AAGAAAGCTGTAAGAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V4-10        AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGGATACAT
S15V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAGGGATACAT
S15V3-9         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACAT
S15V4-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-1         AAGGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGAATACCT
S15V1-11        AATAAATCTGTAGAAATTAATTGTACAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V2-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V2-8         AAGGAATCTGTAGTAATTAATTGTACAAGACCCGACAACAATACAAGAAGAAGGATACCT
S15V2-9         AATGAATCTGTAAGAATTAATTGTACAAGACCCGACAACAATACAAGAAGAAGGATACCT
S15V1-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAATAATACAAGAAGAAGGATACCT
S15V2-7         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V3-2         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-4         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V3-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-1         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-5         AATGAATCTGTAGAAATTAATTGTACAAGACCCAGCAACAATACAAGAAGAAAGATACCT
S15V3-3         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-6         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-7         AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V3-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
S15V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAAGATACCT
                **  **  ****  *** ******* *******  *** ************   **** *
S15V2-5         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-3         ATAGGACCAGGGAAAGCATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-2         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-8         ATGGGACCAGGGAAAGCATTTTA---TACAGGAGAGATAATAGGAGATATAAGGCAAGCA
S15V2-2         ATAGGACCAGGGAAAGCATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V2-4         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-3         ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-12        ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-9         ATAGGACCAGGGAGAACATTTTA---TACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V1-10        ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-5         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-6         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-4         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-7         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-10        ATAGGACCAGGGAAAACATTTTA---TACAGGAGAAATAATAGGAAATATAAGGCAAGCA
S15V4-6         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-9         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V3-9         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-7         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-8         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-5         ATAGGACCAGGGAAAACATTTTA---TACAGGAGACATAATAGGAAATATAAGGCAAGCA
S15V4-2         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-1         ATAGGACCAGGGAACGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-11        ATAGGACCAGGGAACGCATTTTA---TACGACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-6         ATAGGACCAGGGAGCGCATTTTATACTACAGGAGACATAATAGGAGATATAAGGCAAGCA
S15V2-8         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-9         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V1-1         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V2-7         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-2         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-4         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-1         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-1         ATAGGACCAGGGAGCGCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-5         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-3         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V3-6         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V3-7         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V3-8         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAAATATAAGGCAAGCA
S15V4-3         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
S15V4-4         ATAGGACCAGGGAGCTCATTTTA---TACAACAGGCATAATAGGAGATATAAGGCAAGCA
                ** **********   *******   ***   **  ********* **************
S15V2-5         CATTGTAACATTAGTAGTTCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-3         CATTGTAACATTAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-2         CATTGTAACATTAGTAGATCAAATTGGAATAGCACTTTAAAACAGATAGTTAACAAATTA
S15V1-8         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTA
S15V2-2         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGAGAACAAATTA
S15V2-4         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGAGAACAAATTA
S15V1-3         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-12        CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-9         CATTGTAACATTAGTAGATCAAATTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-10        CATTGTAACATTAGTGGATCAAAATGGAATAGCACTTTAAAACAGATAGTTAACAAATTA
S15V1-5         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-6         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAATTTA
S15V1-4         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-7         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-10        CATTGTAACATTAGGGGTTCAAAATGTAATAACACTTTAAAACAGACAGTTAACAAATTA
S15V4-6         CATTGTAACATTAGTGAGTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-9         CATTGTAACATTAGGGGTTCAAAATGTAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-9         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-5         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-2         CATTGTAACATTAGTACTCGAATGTGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-1         CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-11        CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-6         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTA
S15V2-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGAGAACAAATTA
S15V2-9         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V1-1         CATTGTAACAATAGTGGATCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V2-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-2         CATTGTAACATTAGTATTACAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-4         CATTGTAACATTAGTATTACAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-1         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-1         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-5         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-3         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-6         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-7         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V3-8         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-3         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S15V4-4         CATTGTAACATTAGTGGTTCAAAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
                ********** ***      *   ** ***  ************** **  ***** ***
S15V2-5         CTAGAACAATTTGTGAATAAACACATAGTCTTTAATCAATCCTCA
S15V2-3         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAGTCCTCA
S15V1-2         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-8         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V2-2         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V2-4         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V1-3         CGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-12        AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V1-9         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-10        AGAGAACAATTTGTGAATAAACCAATAATCTTTAATCAATCCTCA
S15V1-5         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-6         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAACCAATCCTCA
S15V1-4         AGGGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V1-7         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-10        AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCATTCCTCA
S15V4-6         ACAGAACAATTGGAGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-9         AGAGAACAATTTGGGAATAAAACAATAATCGTTAATCAATCCTCA
S15V3-9         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-7         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S15V4-8         AGAGAACAATTTGGGAATAAAACAATAATATTTAATCAATCCTCA
S15V4-5         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-2         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-1         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAATCAGTCCTCA
S15V1-11        AGAGAACAATTTGTGAATAAAACAATAGTATTTAATCAATCCTCA
S15V2-6         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-8         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-9         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V1-1         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V2-7         AGAGAAACATTTGTGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-2         AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCTATCCTCA
S15V3-4         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-1         AGAGAACAATTTGGGATTAAAACAATAATATTTAATCAATCCTCA
S15V4-1         AGAGAACAATTTGGGATTAAAACAATAATATTTAATCAATCCTCA
S15V3-5         AGAGAACAATTTGGGAATAAAACAATAATGTTTAATCAATCCTCA
S15V3-3         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-6         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCTATCCTCA
S15V3-7         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V3-8         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAATCCTCA
S15V4-3         AGAGAACAATTTGTGAATAAAACAATAATCTTTAATCAGTCCTCA
S15V4-4         AGAGAACAATTTGGGAATAAAACAATAATCTTTAATCAGTCCTCA
                   ***  *** * ** ****   *** *  **** *  ******
  • Calculated theta organized in the table below:
Table 2
Subject Number of Clones S Theta
3 39 42 9.88
6 54 71 14.67
15 40 75 15.31

Activity 3

  1. Our question is: How does the grouping of Subject 7 as a moderate progressor as compared to Subject 7 as a rapid progressor change slope of diversity/divergence as well as compare to rapid progressor phylogenetic trees?
  2. Hypothesis: We hypothesis that changing Subject 7 to a rapid progressor would increase signficance between moderate and rapid progressor group slope of diversity and divergence. We also hypothesis that Subject 7's phylogenetic tree would more closely resemble rapid progressor phylogenetic trees as opposed to moderate progreessor phylogenetic trees.
  3. Subjects, Visits, Clones:
  • Subjects: Subjects 4, 10, 11, 15, 3, 1 (rapid progressors) and Subjects 8, 14, 5, 9, 6, 7 (moderate progressors)
  • Visits: All visits
  • Clones: All clones pertaining to subjects used
  • We justified our subjects, visits, and clones based on wanting to compare slope of diversity/diversity and phylogenetic trees of all rapid progressors to all moderate progressors when subject 7 is moved from moderate to rapid.

Data and Files

Media:CDphylo_tree4sequences.png

Media:CDphylo_tree12sequences.png

Nucleotide Sequence Data

Visit_1_Subjects_1_thru_9_HIV.txt

Visit_1_Subjects_10_thru_15_HIV.txt

Media:CD_sequences.zip

Conclusion

To prepare for the upcoming research project, this week's understanding of the online tools for making phylogenetic trees and aligning sequences was extremely essential. By using the data from the paper, creating phylogenetic trees with the sequences allowed visualization of the data and validation of their data. For further use, these skills in analyzing data will allow for a more in depth analysis of not just the data itself but how it was analyzed and discussed.

Acknowledgments

  • I copied the table syntax for subject/clone # from Week 5 Class Assignment (https://openwetware.org/wiki/BIOL368/S20:Week_5)
  • I worked with User: adinulos for this assignment during class where we discussed further what we wanted to do for our research question.
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Cdominguez (talk) 16:12, 13 February 2020 (PST)

References