Adinulos Week 5

From OpenWetWare
Jump to navigationJump to search

Template

Link to template

User Page

Annika G. Dinulos

Assignments

Journal Pages

Class Journal Pages

Purpose

Methods/Results

Activity 1

Part 1: Pubmed

  • I was able to access the PubMed entry by going to the NCBI website, clicking on the link for the PubMed Search Engine, and then entering the PubMed ID found in the article citation into the search bar. The sequences were all listed on the side under related information, with sections like MedGen, Nucleotide, and others.
  • Other ways for obtaining the article information could have been typing in the authors names or the title of the journal article.
  • Other related information include references, taxonomy and protein sequences.

Part 2 GenBank

  • The accession number of the sequence I chose was AF089153.
  • The sequence was obtained from Subject 4.
  • The definition section of the record contains information about the subject, the visit, the clone and the type of isolate of HIV.

Part 3: Introduction to Phylogeny.fr

Alignment in Clustal Format CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


AF089141.1      GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
AF089501.1      GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
AF016767.2      GGGGTAGTAATTAGATCCGAAAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTG
AF089481.1      GAGGTAGTAATAAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
AF089153.2      GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
               *  *** **** ***** *  ****** *  ************  *** ***********
AF089141.1      AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAA--
AF089501.1      AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
AF016767.2      AATGAATCTGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAC--
AF089481.1      AATAAAGCTGTAGAAATTAATTGCACAAGACCCAACAACAATAAAAGAAGAAGAATAA--
AF089153.2      AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACCATACAGTAAGAAAGATAC--
               *** ** *****  *** ***** *********  ****  ** *  *  **   **   
AF089141.1      -CTCTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAA
AF089501.1      CATATAGGACCAGGGAGACCATTCTATACAACAGG---AATAAAAGGAAATATAAGACAA
AF016767.2      -ATATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCA
AF089481.1      -GTATGGGACCAGGGAGAGTATTGTATACAACAGGAGAAATAATAGGAGATATAAGGCAA
AF089153.2      -CTATAGGACCAGGGAGAGCATTTTATACAACAGG---CAGAATAGGAGATATAAGGCAA
                 * * ******** ***  **  ***********    * ** ***  *******   *
AF089141.1      GCACATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAA
AF089501.1      GCACATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAA
AF016767.2      GCATATTGTAACATTAGTAGAGCAGAATGGGATAACACTTTAAAACAGATAGTTATAAAA
AF089481.1      GCACATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTAACAAA
AF089153.2      GCACATTGTAACATTAGTAGAACAAAATGGAATAACACTTTAAAACTGATAGTTAACAAA
               *** ******** ********  *   **  ** * ****** **    *** *   ***
AF089141.1      TTAAGAGAACAATTTCA---GAATAAAACAATAGCCTTTAATCAATCCTCA
AF089501.1      TTAAGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
AF016767.2      TTAAGAGAACACTTTGG---GAATAAAACAATAGTCTTTAATCACTCTTCA
AF089481.1      TTAAGGGAACAATTTAG---GAATAAAACAATAATCTTTAATCAATCCTCA
AF089153.2      TTAAGAGAACAATTTAG---GAATAAAACAATAATCTTTAATCAATCCTCA
               ***** ***** * *     *************  ****** **  *   *

Phylogenetic Tree

PhylogeneticTreeAnnika.png

  • Differences in the sequences are seen in the distances between the branches as well as the number of branches present for each strain.

Activity 2

Part 1

Alignment in Clustal Format CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S7V1-6          GAGGTAGTAATTAGATCTGCCAATTTCACGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-9          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAGACCATAATAGTACAGCTG
S7V1-7          GAGATAGTAATTAGATCTGCCAATTTCTCGGACAATACTAAAACCATAATAGTACAGCTG
S10V1-3         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-7         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S10V1-5         GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
S1V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S1V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-8         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-6         GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S15V1-10        GGGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
               * * ************* *  ****** ** ***** **** * ****************
S7V1-6          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-9          AGTGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT
S7V1-7          AATGTATCTGTAGAAATTAATTGTACGAGACCCAACAACAATACAAGAAAAAGTATACCT 
S10V1-3         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-7         AATAAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S10V1-5         AATAAATCTGTAGAAATTAATCGCACAAGACCCAACAACAATACAAGAAGAAGTATAAAT
S1V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S1V1-6          AATGAATCTGTAGAAATTAACTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S15V1-8         AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGTATACCT
S15V1-6         AAGGAAGTTGTAAGAATTAATTGTATAAGACCCAACAACAATACAAGAAGAAGGATACCT
S15V1-10        AAGGAAGCTGTAAGAATTAATTGTATAAGACCCAACAATAATACAAGAAGAAGGATACCT
               *    *  ****  ******  * *  *********** ********** *** ***  *
S7V1-6          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-9          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S7V1-7          ATAGGACCAGGGAGAGCATTTTATGCTACAGGAGAAATAATAGGAAATATAAGACAAGCA
S10V1-3         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAACAGGAGATATAAGGCAAGCA
S10V1-7         ATGGGACCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S10V1-5         ATGGGGCCAGGGAGAGCATTTTATACAACAGGAGAAATAATAGGAGATATAAGGCAAGCA
S1V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACCAGCA
S1V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S1V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S15V1-8         ATGGGACCAGGGAAAGCATTTTAT---ACAGGAGAGATAATAGGAGATATAAGGCAAGCA
S15V1-6         ATAGGACCAGGGAGCGCATTTTATACAACAGG---CATAATAGGAGATATAAGGCAAGCA
S15V1-10        ATAGGACCAGGGAGCGCATTTTATACAACAGG---CATAATAGGAGATATAAGGCAAGCA
               ** ** ***** *  *********   *****    **** **** ******* * ****
S7V1-6          CATTGTACCGTAAGTAGAGTAAAATGGAATAACACTTTAAAACAGATAGTTACAAAATTA
S7V1-9          CATTGTAACATTAATAGAGCAAAATGGAATAACACTTTAAAGCAGATGGCTACAAAATTA
S7V1-7          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTACAAAATTA
S10V1-3         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-7         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S10V1-5         CATTGTAACCTTAGTAGAACAAAATGGAATGACACTTTAAAACAGGTAGTTGACAAATTA
S1V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAACAAATTA
S1V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S1V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAGACAGATAGTTATAAAATTA
S15V1-8         CATTGTAACATTAGTAGATCAAAATGGAATCACACTTTAAAACAGATAGTTAACAAATTA
S15V1-6         CATTGTAACATTAGTATAACAGAATGGAATAACACTTTAAAACAGATAGTTAACAATTTA
S15V1-10        CATTGTAACATTAGTGGATCAAAATGGAATAGCACTTTAAAACAGATAGTTAACAAATTA
                ****** * * * *  *  * ********  ********  *** * * *   ** ***
S7V1-6          AGAGAACAATTTGGGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-9          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S7V1-7          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAATCAATCCTCA
S10V1-3         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-7         GGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S10V1-5         AGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCTCA
S1V1-5          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S1V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S15V1-8         AGAGAACAATTTGTGAATAAAACAATAATATTTAATCAATCCTCA
S15V1-6         AGAGAACAATTTGTGAATAAAACAATAGTCTTTAACCAATCCTCA
S15V1-10        AGAGAACAATTTGTGAATAAACCAATAATCTTTAATCAATCCTCA
                ** **** ***  ******* ***** * ***** ** ******

Activity 2 Phylogenetic Tree

Activity2TreeAnnika.png

Table 2
Subject Clone #
Subject 1 3
5
6
Subject 7 6
7
9
Subject 10 3
5
7
Subject 15 6
8
10
  • The clones from each subject do seem to cluster together, it is especially apparent with subject 10.
  • Subjects 1, 7. and 15. show diversity with because each clones has their own branch.
  • None of the subjects seem to cluster together
  • The clustering pattern of the tree seems to be conserved within the subjects. Subject 10 shows clustering within the clones, indicating how closely related they are.

Part 2

Subject 3 Clustal Format

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S3V6-2          GATGTAGTAATCAGATCTGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-4          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-5          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-3          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-6          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V6-1          GATATAGTAATTAGATCTGCCAATTTCTCGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-5          GAGGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-2          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATTCTAAAACCATAATAGTACAGCTG
S3V3-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V1-3          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V1-4          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-3          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-7          GATGTAGTAATCAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V5-2          GATGTAGTAATCAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-9          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-1          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATACTAGTACAGCTG
S3V5-10         GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-7          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-8          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-4          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-5          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V5-6          GATGTAGTAATTAGATCCGCCAATTTCACGAACAATGCTAAAACCATATTAGTACAGCTG
S3V3-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-10         GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-9          GATGTAGTAATTAGATCCGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V3-7          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATACTAGTACAGCTG
S3V4-8          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-1          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V1-2          GATGTAGTAATTAGATCCGCCAATTTCTCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-2          GATGTAGTAATTAGATCCGCCAATTTCGCGGACAATGCTAAAACCATACTAGTACAGCTG
S3V4-3          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-1          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V4-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAGACCATATTAGTACAGCTG
S3V3-5          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V4-9          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATATTAGTACAGCTG
S3V3-8          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATATTAGTACAGCTG
S3V3-4          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAATCATAATAGTACAGCTG
S3V4-6          GATGTAGTAATTAGATCCGCCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG
               **  ******* ***** ********* *  ***** **** * **** ***********
S3V6-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V6-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V3-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V1-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGAGTAACT
S3V5-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V5-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-10         AATGAAACTGTAGTAATGAATTGTACAAGACCCGACAACAATACAAGAAAAAGGGTAACT
S3V3-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-7          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT 
S3V4-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V1-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-2          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-3          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAATAATACAAGAAAAAGGGTAACT
S3V4-1          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-5          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-9          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-8          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V3-4          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
S3V4-6          AATGAAACTGTAGTAATGAATTGTACAAGACCCGGCAACAATACAAGAAAAAGGGTAACT
               ********************************** *** ************** ******
S3V6-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-3          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-6          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V6-1          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-2          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-3          CTAGGACCAGGCAAAGTATACTACACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-4          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-2          CTAGGACCGGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATGAGAAAAGCA
S3V5-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGGGATATAAGAAAAGCA
S3V5-7          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-4          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-5          CTAGGACCAGGCAGAGTATACTATACCACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V5-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-10         CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-7          CTAGGACCAGGCAGAGTATACTATACAATAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-8          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-1          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V1-2          CTAGGACCAGGCAAAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-2          CTAGGACCAGGCAAAGTATATTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-3          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-1          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-5          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-9          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-8          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V3-4          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
S3V4-6          CTAGGACCAGGCAGAGTATACTATACAACAGGACAAATAATAGGAGATATAAGAAAAGCA
               ******** **** ****** ** ** * *************** ***** *********
S3V6-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-4          CATTGTAACCTTAGTAGAGCGGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-5          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-3          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V6-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAGCACTTTAGAAAGGATAGCTATAAAATTA
S3V6-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAACAAGGATAGCTATAAAATTA
S3V3-2          CATTGTAACCTTAGTAGAGCAGGTTGGGCTAACACTTTAGAAAGGATAGCTGTAAAATTA
S3V3-1          CATTGTAACCTTAGTAGAACAGGTTGGAGTAACACTTTAAAAAGGATAGCTGTAAAATTA
S3V1-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-4          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V5-3          CATTGTAACCTTAGTAGAGCGGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-7          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAGGGATAGCTATAAAATTA
S3V5-2          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-9          CATTGTAACCTTAGTTGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-10         CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-7          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-8          CATTGTAACCTTAGTAGAGCAGGTTGAAATAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V5-5          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V5-6          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-6          CATTGTAACCTTAGTAGAGCAGATTGGAGTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-10         CATTGTAACCTTAGCAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-9          CATTGTAACCTTAGTAGAGCAGGTTGGAGTAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-3          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V3-7          CATTGTAACCTTAGTAGAGCAGGTTGGACTAACACTTTAGAAAGAATAGCTATAAAATTA
S3V4-8          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-1          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V1-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-2          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-3          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-1          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V4-4          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAGAAAGGATAGCTATAAAATTA
S3V3-5          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-9          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-8          CATTGTAACCTTAGTAGAGCAGATTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V3-4          CATTGTAACCTTAGTAGAGCAAGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
S3V4-6          CATTGTAACCTTAGTAGAGCAGGTTGGAATAACACTTTAAAAAGGATAGCTATAAAATTA
               **************  ** *   ***   ** *******  * * ****** ********
S3V6-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-4          TGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V6-5          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAACCAATCCTCA
S3V6-6          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V6-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-5          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V3-2          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-1          AGAGAACAATTTCAGAATAGAACAATAGGCTTTAATCAATCCTCA
S3V1-3          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V1-4          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V5-3          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-7          TGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V5-2          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-9          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-1          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-10         AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-7          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V5-8          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-4          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-5          AGAGAACAATTTCAGAATAAAACAATATTCTTTAATCAATCCTCA
S3V5-6          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V3-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-10         AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-3          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-7          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V1-1          AGAGAACAATTTCAGAATAAAACAATAGTCTTTAATCAATCCTCA
S3V1-2          AGAGAACAATTTCAGAATAAAACAATAGCCTTTAATCAATCCTCA
S3V4-2          AGAGAACAATTTCAGAATAAAACAATAGGCTTTAATCAATCCTCA
S3V4-3          AGAGAACAATTTCAGAATAGAACAATATTCTTTAATCAATCCTCA
S3V4-1          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-5          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-9          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-8          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V3-4          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
S3V4-6          AGAGAACAATTTCAGAATAGAACAATAGTCTTTAATCAATCCTCA
                ****************** *******  ****** *********
Subject 11 Clustal Format

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S11V1-4         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAATAATGCTAAAAACATAATAGTACAGCTG
S11V3-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-7         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-1         GAGGTAATAATTAGATCTAAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-10        GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-8         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-5         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-6         GAGGTAATAATTAGGTCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-1         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-4         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-6         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-9         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V4-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V1-3         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V2-2         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
S11V3-7         GAGGTAATAATTAGATCTGAGAATTTCTCAAACAATGCTAAAAACATAATAGTACAGCTG
                ************** *** ************* ***************************
S11V1-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-8         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACCAAGGATAATA
S11V3-5         AATAAATCTGTAGTAATTAATTGTACAAGACCCGATAACACTATAAAACAAAGGATAATA
S11V1-2         AATGAATCTGTAGTAATTACTTGTACAAGACCCGACAACACTATCAAACAAAGGATAATA
S11V4-2         AATGAATCTGTAGTAATTAATTGTGCAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V4-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACTACACTATAAAACAAAGGATAATA
S11V1-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-10        AATGAATCTGTAGTAATTAATTGTACGAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-8         AATGAATCTGTAGTAATTAATTGTACCAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-4         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-5         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-1         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-3         AATGGATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-4         AATGAATCTGTAGTGATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-6         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-9         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V4-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V1-3         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V2-2         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
S11V3-7         AATGAATCTGTAGTAATTAATTGTACAAGACCCGACAACACTATAAAACAAAGGATAATA
                ***  ********* **** **** * ********  ******* **** **********
S11V1-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-5         CATATAGGACCAGGGAGACCATTCTATACAACAGAAATAAAAGGAAATATAAGACAAGCA
S11V1-2         CATATAGGACCAGGGAGACCATTCTATACGACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-9         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V4-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAGATATAAGACAAGCA
S11V3-10        CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-8         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-5         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-5         CATATAGGACCAGGGAGACCATTCTATACAACAAGAATAAAAGGAAATATAAGACAAGCA
S11V2-6         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-1         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-4         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-6         CATGTAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-9         CATATAGGACCAGGGAGACCATTCTATACAGCAGGAATAAAAGGAAATATAAGACAAGCA
S11V4-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V1-3         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V2-2         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
S11V3-7         CATATAGGACCAGGGAGACCATTCTATACAACAGGAATAAAAGGAAATATAAGACAAGCA
                *** *************************  **  ********** **************
S11V1-4         CATTGTAACGTTAGTGAGGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-8         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAACTTA
S11V3-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-2         CATTGTAACGTTAGTGGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTATAAAATTA
S11V4-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTAAGAAAATTA
S11V4-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V1-7         CATTGTAACGTTAGTAGAGGACAATGGGATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAAAAAATTA
S11V3-10        CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-8         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTGGAAAATTA
S11V1-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAGATTA
S11V2-3         CATTGTAACGTTAGTAGAGGACAATGGAATAGAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-5         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-1         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-4         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-6         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-9         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V4-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V1-3         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V2-2         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
S11V3-7         CATTGTAACGTTAGTAGAGGACAATGGAATAAAACTTTAGAACAGGTAGTTAGAAAATTA
                ***************   ********* *** ******************   **  *** 
S11V1-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-5         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-2         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-6         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-5         AGAGAACAATATGGGCCTAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-1         AGAGAACAATATGGACTGAACAAAACAATAGTCTTTAAGCAACCCATA
S11V4-9         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-1         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-4         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-1         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-3         AGAGAACAATATGGACTAAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-10        AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-8         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V1-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-5         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-1         AGAGAACAATATGGACCGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-4         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-6         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-9         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V4-7         AGAGAACAATATGGACTGAATAAAACAATAGCCTTTAAGCAACCCATA
S11V1-3         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V2-2         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
S11V3-7         AGAGAACAATATGGACTGAATAAAACAATAGTCTTTAAGCAACCCATA
                ************** *  ** ********** ****************
Subject 2 Clustal Sequence

CLUSTAL FORMAT: MUSCLE (3.8) multiple sequence alignment


S2V4-3          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCCG
S2V4-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-7          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-4          GAGGTAGTAATTAGATCCGAAAATTTCATGAGCAATGCTAGAATCATAATAGTACAGCTG
S2V3-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-5          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-3          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTGAAATCATAATAGTACAGCTG
S2V1-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V1-1          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-6          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTG
S2V3-9          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-2          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-7          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-8          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V3-5          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-4          GAGGTAGTAATTAGATCCGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTA
S2V4-1          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
S2V4-2          GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCATAATAGTACAGCTG
                ***************** ********** ** *******  *** *************  
S2V4-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-8          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-7          AATGAATCTGTAGAAATTAATTGTACAAAACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-3          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V4-6          AATGAGTCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAGAAAGTATACAT
S2V1-5          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-4          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-3          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-1          AATGGATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V1-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-6          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-9          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V3-7          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V3-8          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACAAGAAAAAGTATACAT
S2V3-5          AATAAATCTGTAGAAATTAATTGTACAAGGCCCAACAACAATACGAGAAAAAGTATACAT
S2V4-4          AATGAATCTGTAGAAATTAATTGCACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-1          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
S2V4-2          AATGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
                ***   ***************** ****  ************** *** ***********
S2V4-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V4-8          ATAAGACCAGGTAGAGCATTTTATACAACAAGAGACATAATAAGAGAGATAAGACAAGCA
S2V4-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAAACATAATAGGAGATATAAGACAAGCA
S2V3-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-3          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAAGAGATATAAGACAAGCA
S2V1-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V1-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-6          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-9          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-7          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-8          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V3-5          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-4          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-1          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
S2V4-2          ATAGGACCAGGTAGAGCATTTTATACAACAGGAGACATAATAGGAGATATAAGACAAGCA
                *** ************************** ** ******** **** ************
S2V4-3          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-5          CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-8          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-5          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACTCTTTAAAACAGATAGTTATAAAATTG
S2V1-3          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V1-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V3-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V1-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTG
S2V3-6          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-9          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V3-7          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTCAAAACAGATAGTTAAAAAATTA
S2V3-8          CATTGTAACATTAGTAGAGCAGAGTGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V3-5          CATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-4          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTATAAAATTA
S2V4-1          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
S2V4-2          TATTGTAACATTAGTAGAGCAGAATGGAATAACACTTTAAAACAGATAGTTAAAAAATTA
                 ******************** * ********* *** ************** ****** 
S2V4-3          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGCCACTCCTCA
S2V4-5          AGAAAACAATTTGAGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V4-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-7          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-3          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-5          AGAGAACACTTTGGAAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-4          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-3          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V1-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAGTCACTCCTCA
S2V3-1          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-9          AGAAAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V1-1          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-6          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-9          AGAGAACACTTTGGGAATAAAACAATCGTCTTTAATCACTCCTCA
S2V3-2          AGAGAACACTTTGGGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-7          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-8          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V3-5          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-4          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-1          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
S2V4-2          AGAGAACACTTTAAGAATAAAACAATAGTCTTTAATCACTCCTCA
                *** **** ***   *********** *******  *********


Table 3
Subject Number of Clones S Theta
3 39 45 10.6
11 31 35 8.7
2 24 36 9.6


Activity 3

  1. Our question is: How does the grouping of Subject 7 as a moderate progressor as compared to Subject 7 as a rapid progressor change slope of diversity/divergence as well as compare to rapid progressor phylogenetic trees?
  2. Hypothesis: We hypothesis that changing Subject 7 to a rapid progressor would increase signficance between moderate and rapid progressor group slope of diversity and divergence. We also hypothesis that Subject 7's phylogenetic tree would more closely resemble rapid progressor phylogenetic trees as opposed to moderate progreessor phylogenetic trees.
  3. Subjects, Visits, Clones:
  • Subjects: Subjects 4, 10, 11, 15, 3, 1 (rapid progressors) and Subjects 8, 14, 5, 9, 6, 7 (moderate progressors)
  • Visits: All visits
  • Clones: All clones pertaining to subjects used
  • We justified our subjects, visits, and clones based on wanting to compare slope of diversity/diversity and phylogenetic trees of all rapid progressors to all moderate progressors when subject 7 is moved from moderate to rapid.


Data and Files

 Activity 1 Phylogenetic Tree
 Activity 2 Phylogenetic Tree
 Visit_1_Subjects_1_thru_9_HIV.txt
 Visit_1_Subjects_10_thru_15_HIV.txt

Conclusion

  • The tools bioinformatics tools that were used this week were very helpful to visualize data on phylogenetic trees and in sequence. It allowed for easier comparison and analysis of sequences within and between subjects which is very useful for our future project.


Acknowledgments

  • I worked with my partner Christina Dominguez on the class assignment and refining our question
  • I copied the wiki syntax for Table 2 and Table 3 from the Week 5 assignment page to organize my collected data
  • Sequences were obtained from PubMed
  • Harmonic Sum calculator from Math Utah was used to calculate harmonic sum
  • Data for all the subjects was obtained from the BEDROCK website
  • Except for what is noted above, this individual journal entry was completed by me and not copied from another source.

Adinulos (talk) 14:14, 13 February 2020 (PST)

References