Search results
From OpenWetWare
Jump to navigationJump to search
- Biophys. Chem. 20: 387-414 (1991). 9. Lauffenburger, D.A., "Bacterial Chemotaxis and Microbial Ecology", Microb. Ecol. 22: 175-185 (1991). 10. Ford, R.M....50 KB (8 words) - 21:01, 13 December 2005
- Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14...9 KB (12 words) - 21:11, 6 May 2015
- 268 267 . . . . 17 18 19 20 . . 143 144 145 146 . . 269 270 271 272 . . 24 23 22 21 . . 150 149 148 147 . . 276 275 274 273 . . 25 26 27 28 . . 151 152 153...6 KB (521 words) - 14:36, 27 July 2006
- Narkosetiefemonitoring zwischen awareness und outcome (Editorial). Der Anaesthesist 2019, 68(9): 581–582 link Kowark A, Rossaint R, Keszei AP, Bischoff P, Czaplik M, Drexler...28 KB (3,240 words) - 07:46, 14 September 2021
- poor temporal precision (SD = 70 ms). J Vis. 2009 Dec 8;9(13):9.1-14. DOI:10.1167/9.13.9 | PubMed ID:20055542 | HubMed [LinaresHolcombeWhite2009] Wojtach...15 KB (3,286 words) - 02:51, 25 February 2025
- GCTCATTCAGCTTTCATCAACTCTGCCAGTTTGAGACCGCTT oligo 22 c5.0.1.22 CTGGTGCCAAGGCGATTAAGTTGGGTAACGCCAGGCGACGGC oligo 23 c5.0.1.23 CAGTGCCATTCATTGAATCCCATAGTAAGAGCAACACTATCA...35 KB (134 words) - 20:28, 12 September 2006
- 10:14, 21 October 2009 (EDT) 10/23 (rec 10/29), Global Test Supply (Epoxy), $37.40 + S&H , acct 6919767 --Francisco 22:14, 29 October 2009 (EDT) 10/26...20 KB (2,544 words) - 15:19, 16 July 2010
- Advanced Electrode Localizer. eNeuro 19 October 2023, 10 (10) ENEURO.0328-23.2023 Click here for the journal full text Click here for the PDF. Click here...37 KB (4,582 words) - 19:55, 11 April 2025
- 6a/b splicing isoforms in melanoma. Pigment Cell Melanoma Res. 2010 Feb;23(1):93-102. DOI:10.1111/j.1755-148X.2009.00652.x | PubMed ID:19895547 | HubMed [Paper20]...3 KB (26 words) - 14:41, 16 February 2012
- 106: 4629-4634 (2009). [22] Kohanski MA and Collins JJ. Rewiring bacteria, two components at a time. Cell 133: 947-948 (2008). [23] Guido NJ, Lee P, Wang...18 KB (2,054 words) - 19:41, 28 September 2009
- Beginner's Python Tutorial [21] Python Tutorials List and Links [22] Python:Choose Your GUI Toolkit [23] Building GUI Applications with PythonCard and PyCrust [24]...27 KB (1,648 words) - 03:07, 5 August 2008
- subtypes of glioblastoma multiforme." Proc Natl Acad Sci U S A 2005; 102: 16: 5814-9 Arava Y, Boas FE, Brown PO, Herschlag D "Dissecting eukaryotic translation...44 KB (7,714 words) - 23:48, 8 May 2008
- mediating activity-dependent plasticity in visual cortex. Nature Neuroscience 9:660-668. Kreiman G*, Hung C*, Quiroga R, Kraskov A, Poggio T., DiCarlo J. (2006)...20 KB (8 words) - 16:11, 25 October 2010
- cells (NF-κB) in mice. Hepatology. 2011 Oct;54(4):1421-32. PMID: 21735468 (9/23/16, 공미) Petrocca F, Altschuler G, Tan SM, Mendillo ML, Yan H, Jerry DJ, Kung...59 KB (9 words) - 09:01, 21 August 2024
- (XS) 17-987-145A 1 $22.21 $22.21 9/24/2007 Fiona Chen Genesee Scientific Autoclave Container Polypropylene 20 oz 88-111 1 $6.50 $6.50 9/24/2007 Andrew N....38 KB (119 words) - 03:29, 21 September 2008
- 000 9, 0, 000 10, 0, 000 11, 0, 000 12, 0, 000 13, 0, 000 14, 0, 000 15, 0, 000 16, 0, 000 17, 0, 000 18, 0, 000 19, 0, 000 20, 0, 000 21, 0, 000 22, 0...17 KB (2,300 words) - 18:43, 29 October 2007
- (2009) 331-336 - Featured in UCSD news (Feb 23, 2009), Technology Review (Feb 23, 2009), Chemical & Engineering News (Feb 24,...73 KB (9 words) - 01:03, 25 February 2025
- activation in human tissues. Proc Natl Acad Sci USA 2005, 102:4459-446410.1073/pnas.0501076102. 23. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ...13 KB (698 words) - 20:22, 9 November 2013
- tests 2: predictive values Douglas G Altman & J Martin Bland BMJ 1994;309:102 (9 July) Diagnostic tests 3: receiver operating characteristic plots Douglas...10 KB (1,080 words) - 12:45, 23 April 2007
- checklist of procedures,” Brazilian J. Phys. Ther., vol. 24, no. 2, pp. 91–102, Mar. 2020, doi: 10.1016/j.bjpt.2019.02.006. A. M. Catai, C. M. Pastre, M...21 KB (2,770 words) - 12:00, 9 March 2021
