Changes

From OpenWetWare
Jump to navigationJump to search
<br>
<br>
'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - <br>
5' TAATACGACTCACTATAGGG 3'
<br><br>
2,216

edits

Navigation menu