Changes

From OpenWetWare
Jump to navigationJump to search

BISC219/F12: RNAi Lab 7

5 bytes added, 09:01, 13 November 2012
Colony PCR
<br>
<br>
'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - 5' TAATACGACTCACTATAGGG 3' <br><br>
'''PCR Conditions:'''<br>
{| border="1"
2,216
edits

Navigation menu