Changes

From OpenWetWare
Jump to navigationJump to search
<br>
<br>
'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - 5' TAATACGACTCACTATAGGG 3' <br><br>
'''PCR Conditions:'''<br>
{| border="1"
2,216

edits

Navigation menu