2,216
edits
BISC219/F12: RNAi Lab 7: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Colony PCR
| Line 66: | Line 66: | ||
#Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''. | #Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''. | ||
<br> | |||
<br> | |||
'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - 5' TAATACGACTCACTATAGGG 3' | |||
<br> | <br> | ||
'''PCR Conditions:'''<br> | '''PCR Conditions:'''<br> | ||
