96
edits
BME100 s2018:Group9 W0800 L4: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→SNP Information & Primer Design
| Line 152: | Line 152: | ||
Part 3 | Part 3 | ||
The results of the primer testing in UCSC In-Silico PCR, validated that the primers corresponded to the exact mutated genes. The first picture represents the | The results of the primer testing in UCSC In-Silico PCR, validated that the primers corresponded to the exact mutated genes. The first picture represents the results of the primers matching that of the mutation on the gene. In other words, the primers are located on chromosome 6, 220 base pairs apart(200 base-pairs long and 20 bases long).The forward non-disease primer is 5'TTCAGATGACTGCAAGGACA 3' | ||
and the reverse non-disease primer is 5'TGTTTAAAAGTTTCTTTAAT3'. The disease froward primer is 5'TTC AGATGACTGCAAGGACC3'. The disease reverse primer is 5'TGTTTAAAAGTTTCTTTAAT3'. | |||
