IGEM:IMPERIAL/2009/M1

From OpenWetWare
Jump to: navigation, search

Module 1 - Genetic Circuit

In Module 1 (M1), LacI is constitutively produced. LacI represses the LacI repressible promoter which controls the production of PAH/cellulase.

In order to start off M1, we pipette in IPTG. This represses LacI production, which was originally repressing BBa_R0011. BBa_R0011 is the promoter responsible to kick start the production of PAH / cellulase. As the repression on the promoter is now lifted, the genes under the promoter can now be transcribed to produce the PAH/cellulase.

In conclusion, the addition of IPTG represses the productio of functional LacI, and this will subsequently start protein production.

%note that since LacI is being produced constitutively, when the added IPTG is used up, concentrations of LacI will increase again and enzyme production will stop. We can solve this problem by pipetting in IPTG at regular time intervals. This needs further research.

II09 full circuit Mod1.jpg


Module 1 - Protein production

  • People: Charles and Tianyi


DNA constructs

This module is aimed at synthesising the protein of interest that will be subsequently encapsulated. We are focusing on two main proteins for this module. The module however can be easily adapted to other proteins.

Phenylalanine Hydroxylase (PAH)

Mutation in this enzyme has been associated with occurence of Phenylketonuria. Because PAH cannot break-down phenylalanine (an amino acid that cannot be synthesised by the body, it has to come from the diet) into tyrosine, phenylketonuriacs accumulate phenylalanine in the blood and in the brain which in term causes mental retardation if the diet is not tightly controlled. More information on PKU here, here and here

--Kun Xue 09:39, 11 August 2009 (EDT)Whats at each 'here'?

  • Nuri Purswani 06:14, 12 August 2009 (EDT): Do we need to show the entire DNA sequence? maybe a link to it in a new page will be better
   DNA sequence
          ATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGAAACAAGCTATATTGAAGACAACTGCAATCAAAATGGTGCCATATCAC
          TGATCTTCTCACTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCGCTTATTTGAGGAGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAA
          GAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTT
          TCACGAGATAAGAAGAAAGACACAGTGCCCTGGTTCCCAAGAACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCGGAACTGGATGCTGACC
          ACCCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAGTTTGCTGACATTGCCTACAACTACCGCCATGGGCAGCCCATCCCTCGAGTGGAATACATGGAGGA
          AGAAAAGAAAACATGGGGCACAGTGTTCAAGACTCTGAAGTCCTTGTATAAAACCCATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTACTGTGGC
          TTCCATGAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAATTCCTGCAGACTTGCACTGGTTTCCGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCT
          TGGGTGGCCTGGCCTTCCGAGTCTTCCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAACCTGACATCTGCCATGAGCTGTTGGGACATGT
          GCCCTTGTTTTCAGATCGCAGCTTTGCCCAGTTTTCCCAGGAAATTGGCCTTGCCTCTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTT
          ACTGTGGAGTTTGGGCTCTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTACTGCTTATCAGAGAAGCCAAAGC
          TTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAG
          GAACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGGATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGATTCC
          ATTAACAGTGAAATTGGAATCCTTTGCAGTGCCCTCCAGAAAATAAAGTAA

Cellulase

We propose to use a cellulase enzyme able to catalyse all three enzymatic reactions (crystal to cellulose to cellobiose/cellotetrose and to glucose) involved in the degradation of cellulose crystals into glucose. The particular enzyme we will be using is from Clostridium thermocellum Gene/Protein information. Another advantage of using Clostridium's cellulase is that it is protease resistant, therefore will be protease resistant in the target environment of the small intestine. More information can be found here.

   DNA sequence:
          ATGAAAAAAATTGTTTCTTTGGTTTGTGTGCTTGTGATGCTGGTAAGCATCTTAGGCTCGTTTTCAGTCGTAGCGGCATCACCGGTAAAAGGC
          TTTCAGGTATCGGGAACAAAGCTTTTGGATGCAAGCGGAAACGAGCTTGTAATGAGGGGCATGCGTGATATTTCAGCAATAGATTTGGTTAAA
          GAAATAAAAATCGGATGGAATTTGGGAAATACTTTGGATGCTCCTACAGAGACTGCCTGGGGAAATCCAAGGACAACCAAGGCAATGATAGAA
          AAGGTAAGGGAAATGGGCTTTAATGCCGTCAGAGTGCCTGTTACCTGGGATACGCACATCGGACCTGCTCCGGACTATAAAATTGACGAAGCA
          TGGCTGAACAGAGTTGAGGAAGTGGTAAACTATGTTCTTGACTGCGGTATGTACGCGATCATAAATGTTCACCATGACAATACATGGATTATA
          CCTACATATGCCAATGAGCAAAGGAGTAAAGAAAAACTTGTAAAAGTTTGGGAACAAATAGCAACCCGTTTTAAAGATTATGACGACCATTTG
          TTGTTTGAGACAATGAACGAACCGAGAGAAGTAGGTTCACCTATGGAATGGATGGGCGGAACGTATGAAAACCGAGATGTGATAAACAGATTT
          AATTTGGCGGTTGTTAATACCATCAGAGCAAGCGGCGGAAATAACGATAAAAGATTCATACTGGTTCCGACCAATGCGGCAACCGGCCTGGAT
          GTTGCATTAAACGACCTTGTCATTCCGAACAATGACAGCAGAGTCATAGTATCCATACATGCTTATTCACCGTATTTCTTTGCTATGGATGTC
          AACGGAACTTCATATTGGGGAAGTGACTATGACAAGGCTTCTCTTACAAGTGAACTTGATGCTATTTACAACAGATTTGTGAAAAACGGAAGG
          GCTGTAATTATCGGAGAATTCGGAACCATTGACAAGAACAACCTGTCTTCAAGGGTGGCTCATGCCGAGCACTATGCAAGAGAAGCAGTTTCA
          AGAGGAATTGCTGTTTTCTGGTGGGATAACGGCTATTACAATCCGGGTGATGCAGAGACTTATGCATTGCTGAACAGAAAAACTCTCTCATGG
          TATTATCCTGAAATTGTCCAGGCTCTTATGAGAGGTGCCGGCGTTGAACCTTTAGTTTCACCGACTCCTACACCTACATTAATGCCGACCCCC
          TCGCCCACGGTGACAGCAAATATTTTGTACGGTGACGTAAACGGGGACGGAAAAATAAATTCTACAGACTGTACAATGCTAAAGAGATATATT
          TTGCGTGGCATAGAAGAATTCCCAAGTCCTAGCGGAATTATAGCCGCTGACGTAAATGCGGATCTGAAAATCAATTCCACCGACTTGGTATTG
          ATGAAAAAATATCTACTGCGCTCAATAGACAAATTTCCTGCGGAGGATTCTCAAACACCTGATGAAGACAATCCGGGCATTTTGTATAACGGA
          AGATTCGATTTTTCAGATCCGAACGGTCCGAAATGCGCCTGGTCCGGCAGCAATGTTGAGCTGAATTTTTACGGCACGGAAGCAAGTGTGACT
          ATCAAATCCGGCGGTGAGAACTGGTTCCAGGCTATTGTAGACGGCAATCCTCTTCCTCCTTTTTCGGTTAACGCTACTACCTCTACCGTAAAG
          CTTGTAAGCGGTCTTGCAGAAGGAGCTCATCATCTTGTATTGTGGAAGAGGACAGAGGCATCCTTGGGAGAAGTTCAGTTCCTTGGGTTTGAT
          TTTGGTTCAGGAAAGCTTCTTGCCGCACCGAAGCCTTTGGAAAGAAAGATTGAGTTTATCGGAGACTCCATCACATGTGCATACGGAAATGAA
          GGAACAAGCAAGGAGCAGTCTTTTACACCGAAAAATGAAAACAGCTATATGTCTTATGCGGCAATTACAGCCCGTAATTTGAATGCAAGTGCA
          AATATGATTGCGTGGTCCGGAATCGGACTTACCATGAACTACGGCGGAGCCCCCGGACCTCTTATAATGGACCGTTATCCTTATACCCTTCCT
          TACAGCGGAGTCAGATGGGATTTTAGCAAATATGTGCCTCAGGTTGTTGTAATCAATCTTGGTACCAATGATTTTTCTACATCATTTGCAGAT
          AAAACAAAGTTTGTAACGGCATATAAAAACCTTATAAGTGAAGTTCGCAGGAACTATCCGGATGCCCATATATTCTGCTGTGTCGGTCCGATG           
          CTTTGGGGAACGGGCCTGGATTTGTGCCGCAGTTATGTTACGGAAGTTGTAAATGATTGTAACAGAAGCGGGGATTTAAAGGTGTATTTTGTT
          GAGTTTCCGCAGCAGGACGGAAGCACCGGATACGGAGAAGACTGGCATCCAAGTATTGCCACCCACCAGCTGATGGCTGAGCGGCTTACTGCG
          GAAATAAAAAACAAGCTTGGATGGTAA

Cloning strategy (assembly)

M1cs.jpg

Testing constructs are in red, and the genetic circuit for M1 is in black.

Testing Constructs

Promoter Testing

M1testp.jpg

The biobrick used, BBa_E0240 allows us to characterise the promoter. To do so, we attach this biobrick to the end of the promoter we are testing ie, the LacI promoter, BBa_R0011. BBa_E0240 will output GFP. We can indirectly measure the activity of promoters via observing the rates of GFP synthesis. GFP synthesis rate can be estimated by looking at the change in arbiturary fluorescence units per absorbance. Therefore, we'll need a graph of fluorescence vs time. The gradient of the slope of this graph would give rate of GFP synthesis. Subsequently, we can estimate promoter activity, using the equation:

M1eqn1.jpg

This equation can be further simplified by making many assumptions.


Promoter activity is measured in terms of PoPS. Relative promoter activity will be in relative promoter units (RPU). RPU is measured by using the promoter activity of BBa_J23101 as the standard reference. (Refer to Jason Kelly's paper)

Gene Testing

INPUT TESTING CONSTRUCT OUTPUT
HSL (mM) F2620-RBS-Cellulase Gene-TT (-Assay) Fluorescence (RFU)

M1 cloning strategy.jpg


BB2, BBa_F2620 is a well characterised promoter sequence, hence we will know the exact PoPS output for a certain amount of HSL input. By adding BBa_F2620 in front of our gene of interest, we know the exactly what our input PoPS is. We can then measure our PAH / Cellulase output per unit time using the assays. This will give us our PoPS output. In that sense, BBa_F2620 allows us to measure the behaviour of the genes coding for PAH or cellulase, depending on the input concentration of HSL, and will allow us to characterise our own biobricks


II09 F2620.png

Assays & Protocols

Cellulase

PAH

Promoter characterisation

IPTG effect on growth at 28 degrees

Output data

Promoter

  • Graph of fluorescence against time for different IPTG input.
  • Using the formula in the Jason Kelly paper, we can relate fluorescence to GFP synthesis rate per cell, and then to PoPS
  • Nuri Purswani 09:15, 12 August 2009 (EDT): See genetic circuit: inputs Iptg and LacI

PAH

PAH activity: 1 unit = 1 mmol.min-1 @ pH=7.2; 25°C

  • Calibration curve of [PAH] vs colour intensity.


Cellulase

  • The assay output will provide us a measure of Relative fluorescence unit (RFU) over time.
  • We can directly relate RFU to enzymatic activity(U/ml) using a standard curve (See plot below)

II09 calib cellulase.jpg

1995 - Cellulase activity: 1 unit = 1 μmol.min-1 @ pH=5.0; 37°C




  • The slope of the Fluorescence vs Time curve should be the rate of production of fluorescence. Assuming that only the cellulase enzyme can catalyse the above reaction, the slope should represent the activity of the enzyme

Modelling directions

  • Nuri Purswani 09:19, 12 August 2009 (EDT): I think that for the modelling in this part, we should work from our assays and testing constructs.

Possible questions we may want to answer: 1. Promoter characterization as a function of LacI, IPTG. 2. Michaelis-Menten kinetics: ODE models of chemical reactions. We want to relate initial concentrations of substrate in our testing constructs to product and characterize enzymatic activity (of PAH and cellulase). To do this we will first go through the 2nd practical of the computer modelling synth bio course. We will then try to break down our system in a similar manner, noting the key questions we would like to ask.

Input from wet-lab

1) Calibration curve to determine [PAH] and [cellulase].

2) When testing the promoter using BBa_E0240, obtain a graph of fluorescence vs time

Modelling

1) Data analysis : Derive rate of production of cellulase / PAH

2) Modelling:

  1. Cell growth rates
  2. Determine rate of production of PAH / Cellulase

-LacI is produced constitutively, this repressed M1. -When there is IPTG input, it represses LacI below threshold. M1 will kick start. -When there's above threshold IPTG, there would be production of PAH / Cellulose.

M1graphs1.jpg M1graphs2.jpg

  • To characterise any possible biobricks.
  • To characterise promoter, plot GFP vs [IPTG] graphs, and GFP vs time graphs etc
  • To characterise the gene for either PAH or cellulase, plot graphs of IPTG and LacI (produced constitutively) against assay output (which is either fluorsecence, or colour). Also, perhaps generate a 3D graph of IPTG against assay output and time.
  1. Relating PoPs output to colour (PAH) or fluorescence (Cellulose)
  2. PAH / cellulase enzyme kinetics [1]
  • Normalisation of data
  • Fitting of wetlab data (ie activity vs time) to model
  • Transfer functions for
  1. IPTG --> blackbox --> PoPS
  2. HSL --> blackbox --> PoPS (testing construct)
  3. IPTG --> blackbox of M1 --> PAH or cellulase
  4. HSL --> blackbox of M1 --> PAH or cellulase (testing construct)

M1graphs3.JPG


  • use Drew Endy standardisation for PoPS output, so as to relate it to GFP

3) Ultimate aim: Determine a model that treats M1 as a blackbox. ie. IPTG --M1--> PAH / Cellulase

Shopping list

Cellulase Fluorescence 2005 (preferred)

Assay kit Where to buy Price
E33953 EnzChek® Cellulase Substrate *blue fluorescent, 339/452 invitrogen £131.00 / 186 assays


Cellulase Fluorescence 2009

Assay kit Where to buy Price
MarkerGene Fluorescent Cellulase Assay Kit biokit or markergene £105.49 or £138.23 / kit

Cellulase Fluorescence 1995

Reagent Where to buy Notes
Sodium Acetate Buffer, pH 5.0 Sigma 250g, £7.90
Sigmacell Solution (Sigmacell) sigma 300g, £30.90
Glucose (HK) Determination Vial (16-10) sigma@ 20 assays, £38.80

@ - Can be the same kit as M2

Phenylalanine hydroxylase

Reagent Where to buy Notes
Trizma Base sigma 25g, £10.10
L-Phenylalanine sigma 100g, £34.00
Catalase sigma 50mg, £43.00
DL-Dithiothreitol sigma 1g, £19.40
DL-6-Methyl-5,6,7,8-Tetrahydropterine Dihydrochloride sigma 50mg, £69.50
Trichloroacetic Acid, 6.1 N Solution sigma 100ml, £31.40
Nitric Acid sigma -
Sodium Nitrite sigma 25g,£59.50
Nitrosonaphthol sigma 25g, £27.10
Sodium Hydroxide Solution sigma -
L-Tyrosine Free Base sigma 50g, £13.80