BME100 s2018:Group8 W0800 L4

BME 100 Spring 2018	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Jill Leaver Role(s): Protocol, SNP Info, Part of Research and Development, Editing Name: Hector Figueroa Role(s): Part of Research and Development Name: Auhood Alghareed Role(s): Student LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix: 8 tubes, 50 μL each: Each mix contains Taq DNA polymerase, MgCl2 , and dNTP’s DNA/ primer mix: 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips Cup for discarded tips Micropipettor OpenPCR machine PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G8 + Positive control none G8 - Negative control none G8 1-1 Patient 1, replicate 1 86632 G8 1-2 Patient 1, replicate 2 86632 G8 1-3 Patient 1, replicate 3 86632 G8 2-1 Patient 2, replicate 1 58297 G8 2-2 Patient 2, replicate 2 58297 G8 2-3 Patient 2, replicate 3 58297 DNA Sample Set-up Procedure Extract DNA from your source, which can include hair, blood, or skin samples Pipette the DNA into a test tube for PCR, and make sure there is even heat distribution Add the first primer to the same test tube as the DNA Add the second primer on the opposite end on the other strand of DNA, and make sure you change the pipette tip to avoid cross contamination Add nucleotides to the mixture, making sure there are enough to replicate the DNA Add the Taq DNA polymerase to the tube, which will copy the DNA Place the PCR test tube into the thermal cycler OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 Cycle: Denature at 95°C for 30 seconds Anneal at 57°C for 30 seconds Extend at 72°C for 30 seconds Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology DNA is the organic blueprint that allows the billions of nucleotides and proteins to build us into the complex organism that we are. The technological advances in the past decades have made us very dependent on DNA to identify each and every one of us. One of these technological advancements is the Polymerase Chain Reaction (PCR), a process that allows us to replicate a minuscule sample of DNA into millions of identical copies, which makes analysis easier and more approachable. Components The Polymerase Chain Reaction Consists of four components: Template DNA, Primers, Taq Polymerase, and Deoxyribonucleotides (dNTP'S). The template DNA is the original piece of DNA from an organism that is used as a master key to make millions of copies. The primers are nucleotides that attach to either end of the DNA segment that is being copied. Primers are very important in DNA sequencing of very specific sequences since it is very unlikely that they will attach at the wrong site. The Taq Polymerase consists of molecules that act like machines in an assembly line that read the DNA codes of a specific sequence and attaches nucleotides (A,T,C and G) in the correct order to create a replica of the original DNA Template. The Deoxyribonucleotides (dNTPS) are the base pairs, adenine, thymine, guanine, cytosine ( A,T,C,G). They are the building blocks of DNA. The Process When all components of (PCR) are in solution, they must undergo Thermal Cycling in order for the replication process to proceed. The initial step is to raise the temperature to 95 degrees Celsius for 2 minutes. In this step the DNA double helix unwinds, creating two separate strands of DNA. This also allows access to the primers. The Denature step happens at the same temperature for an extra 30 seconds. Here excess primer is added. The temperature then drops to 52 degrees Celsius during the Anneal step. In this step the solution is cooled to allow the Double DNA strands to form again and prepare to bind to the primers. After 30 seconds have passed, Annealing is completed and the process moves to the Extend step, where the temperature rises to 72 degrees Celsius. At this temperature, Taq Polymerase is activated and when it detects a primer attached to a single DNA strand, it begins to add complementary nucleotide bases until it reaches the end of the strand and falls off. The final step is maintaining the temperature at 72 degrees Celsius for an additional 2 minutes, where the original DNA template is then replicated millions of times. Base Pairing of Nucleotides Adenine (A) pairs with Thymine (T). Cytosine (C) pairs with Guanine (G). Base Pairing in Thermal Cycling Base pairing occurs during annealing and extending, where the solution is cooled to 57 degrees Celsius, which allows the DNA strands reform, and are prepare for pairing. The solution is then heated to 72 degrees Celsius where Taq polymerase is activated, and the nucleotide bases are paired with a template DNA strand. SNP Information & Primer Design Background: About the Disease SNP A Single Nucleotide Polymorphism (SNP) is a variation in a single base pair in a DNA sequence. A large majority of the time this one change in the base pair will not have a drastic effect on the person since often, the amino acid the nucleotide codes for is not changed. However, when the coded amino acid does change, the SNP can play a role in coding for a disease, and also for predicting certain diseases. One condition commonly associated with an SNP is type two diabetes. The ENPP1 gene stands for Ectonucleotide Pyrophosphatase/Phosphodiesterase 1, and it binds ATP and calcium ions and is responsible for NADH pyrophosphatase activity. When someone encounters a K121Q polymorphism on the ENPP1 gene, they are more likely to develop a bone disorder if they have type 2 diabetes. Conversely, if the person with this polymorphism is not diabetic, then the ability to predict bone disorders diminishes. Primer Design and Testing Our forward primer was 5'- TTCAGATGACTGCAAGGACA and our reverse primer was 5'- TGTTTAAAAGTTTCTTTAAT. The top image is the non-disease sequence, and the bottom is the disease sequence. The non-disease primer sequence resulted un UCSC In-Silico PCR and was confirmed that the primers worked, whereas the disease primer sequence resulted in no matches because the SNP caused the sequence to differ from the documented non-disease sequence.