PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl 2 , and dNTP’s (hp://www.promega.com/resources/protocols/product‐informaon‐sheets/g/gotaq‐colorless ‐master‐mix‐m714‐protocol/)
DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never reuse disposable pipette tips . If you do, the samples will become cross‐contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G6 +
Positive control
none
G6 -
Negative control
none
G6 1-1
Patient 1, replicate 1
94130
G6 1-2
Patient 1, replicate 2
94130
G6 1-3
Patient 1, replicate 3
94130
G6 2-1
Patient 2, replicate 1
76365
G6 2-2
Patient 2, replicate 2
76365
G6 2-3
Patient 2, replicate 3
76365
DNA Sample Set-up Procedure
First, extract DNA from your source. This can be anything from hair, to blood, to skin samples
Next, pipette the DNA to a test tube specially designed for PCR and even heat distribution.
Now add the first primer to the same test tube as the DNA, making sure to change out the pipette tip to avoid cross-contamination
Add the second primer in a similar way
Now add nucleotides to the mixture to ensure that that there are ample nucleotides to replicate the DNA
Finally, add the Taq DNA polymerase to the tube, which will ultimately copy the DNA. This polymerase is specially designed to withstand temperature change
The PCR test tube is now set up. Place the PCR test tube into the thermal cycler
OpenPCR program We will be using the following parameters for the Open PCR program
Heated Lid: 100 degrees Celsius
Initial Step: 95 degrees Celsius for 2 minutes
Number of Cycles: 25
Denature at 95 degrees Celsius for 30 seconds, Anneal at 57 degrees Celsius for 30 seconds, and
Extend at 72 degrees Celsius for 30 seconds
Final Step: 72 degrees Celsius for 2 minutes
Final Hold: 4 degrees Celsius
Research and Development
PCR - The Underlying Technology
DNA is the special molecule that acts as the "brain" of the nucleus by programming each cell to produce proteins, perform unique functions, and multiply into more cells. Advances in biotechnology in the past couple decades focus heavily on using DNA both to identify and diagnose human diseases and create new cures for genetic diseases. Perhaps the most important advancement in DNA technology is the Polymerase Chain Reaction (PCR), a process that allows scientists to duplicate even minuscule sample of DNA into millions of identical copies. By drastically scaling up the amount of DNA present, analysis and production of strands of DNA becomes elementary.
Components The PCR Consists of four major components: Template DNA, Taq Polymerase, Primers, and deoxyribonucleotides, or dNTP'S. The template DNA strand is a sample of whatever DNA you want to copy. The PCR will replicate this segment of DNA millions of times. Primers are very special molecules composed of nucleotides that attach to each end of the template DNA. Primers almost never attach to the wrong site on DNA, so they allow for almost perfect accuracy in the copying of the DNA. The Taq Polymerase is a specially designed molecule that assembles DNA systematically, attaching a specific sequence of nucleotides (A,T,C and G) in the correct order (according to the base pairs of the template strand) to create a replica of the original DNA Template. The Deoxyribonucleotides (dNTPS) are the molecules that serve as DNA's base pairs, adenine, thymine, guanine, cytosine ( A,T,C,G). These molecules are the ones used by Taq polymerase to make new DNA. In essence, dNTP's are the bricks used to build the house.
The Process
All of these components are first mixed together to form a PCR solution. Next, they must undergo a special regimen of heating and cooling called "Thermal Cycling". This process is what allows new DNA to be made, as explained in the following steps. The first step is to raise the temperature to about 95 degrees Celsius for around 2 minutes. This causes the double helix shape of DNA to unwind, which importantly creates two separate strands of DNA. The separating of DNA strands is what allows primers to bind to the template strand, and thus allows for copies of the DNA to be produced. The next step is the Denature step. In this step, which happens at the same temperature for an extra 30 seconds, excess primer is added. Next, in the Anneal step, the temperature drops to 52 degrees Celsius. This allows the primer to bind to the two DNA strands, thus preparing them to be copied. The process then enters the Extend step, where the temperature rises to 72 degrees Celsius. At this temperature, Taq Polymerase is activated. When Taq Polymerase detects the primer, it begins assembling a new complementary strand of DNA attached to the old DNA strand. Eventually it reaches the end of the strand and falls off. Both of the unwound template strands are copied in this way. The final step is to maintain the temperature around 72 degrees Celsius for 2 more minutes, where the original DNA template is then replicated millions of times. The Thermal cycle is repeated over and over, until eventually the only DNA being copied is the DNA segment of interest, which by the end of a full round of thermal cycling will represent the vast majority of DNA in the solution.
Base Pairing of Nucleotides
Adenine (A) and Thymine (T) are paired, while Cytosine (C) and Guanine (G) are paired.
Base Pairing in Thermal Cycling
Base pairing occurs during annealing, when primers pair with the template strand and extending, where nucleotides are added in a complementary fashion. Base pairing can only occur between the primer and the template at lower temperatures of 52 degrees Celsius, as higher temperatures will lead to denaturing of DNA. Taq polymerase can only add base pairs at a higher temperature because this is the temperature at which polymerase reaches peak function.
SNP Information & Primer Design
Background: About the Disease SNP
A Single-Nucleotide-Polymorphism is a genetic mutation in which only one nucleotide base pair is mutated. This nucleotide is swapped for another and ends up changing the shape of the protein that is produced after translation. This specific mutation, K121Q, which is also known as rs104498, regulates the development of bone disorders in patients with type 2 diabetes, more specifically Type 2 Diabetes Mellitus (T2DM). The change in the protein produced means that someone that has T2DM is more likely to develop a bone disorder if they have K121Q with the specific polymorphism of the ENPP1 gene. However, this same predictive power does not hold if a person is not diabetic. If a non-diabetic person has the K121Q polymorphism ENPP1 gene, the polymorphism will be unable to predict the development of bone disorders effectively.
Primer Design and Testing Our forward primer was: 5'- TTCAGATGACTGCAAGGACA and our reverse primer is: 5'- TGTTTAAAAGTTTCTTTAAT
When we tested our primers in the UCSC In-Silico PCR database, we validated that our primers were the correct primers to target the specific gene that was mutated. As shown on the screen below, we tested the above primers and according to the results, our primers were a perfect match for each end of a 220 base pair sequence on chromosome 6 that corresponds to the same position as the mutation of the gene.
BME 100 Spring 2018
