BME100 s2018:Group4 W0800 L4

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2018 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Charles
Carpenter
Name: Jun
Zhen
Name: Jay
Makan
Name: Fernando
Aguilera

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reacon mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl  2  , and dNTP’s  (hp://www.promega.com/resources/protocols/product‐informaon‐sheets/g/gotaq‐colorless ‐master‐mix‐m714‐protocol/) 
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes  have the same forward primer and reverse primer
  • A strip of empty PCR tubes 
  • Disposable pipette tips: only use each only once.  Never reuse disposable pipette tips  . If you do,  the samples will become cross‐contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G4 P Positive control none
G4 N Negative control none
G4 1-1 Patient 1, replicate 1 10452
G4 1-2 Patient 1, replicate 2 10452
G4 1-3 Patient 1, replicate 3 10452
G4 2-1 Patient 2, replicate 1 45121
G4 2-2 Patient 2, replicate 2 45121
G4 2-3 Patient 2, replicate 3 45121


DNA Sample Set-up Procedure

  1. Gather required materials
  2. Extract DNA into a specialized PCR tube with a pipette
  3. Dispose of the used pipette tip
  4. Repeat step 1-3 with the rest of the DNA samples
  5. Add Primer 1 into each DNA sample using a new pipette tip for each one
  6. Repeat this process with Primer 2
  7. With a new pipette tip, add nucleotides to each DNA sample
  8. Repeat again with the PCR reaction mix for each sample of DNA
  9. Close the lids of each sample and place them in the OpenPCR machine
  10. Press the start button and allow the process of PCR to occur
  11. Allow the cycles to occur for around 5 minutes and 30 seconds


OpenPCR program

  • Heated lid: 100°C
  • Initial Step: 95°C for 2 minutes
  • Number of cycles: 25. Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds
  • Final step: 72°C for 2 minutes
  • Final hold: 4°C



Research and Development

PCR - The Underlying Technology

Function of Components

Template DNA: A single strand of DNA that is copied by a DNA Polymerase enzyme
Primers Primers are short pieces of lab-made DNA that match a section of a DNA strand you want to copy.
Taq Polymerase A set of complex proteins that copy a cell's DNA by attaching itself to a primer and adding nucleotide to the strand.
Deoxyribonucleodes
(dNTP’s)  : 
The building block molecules that make up the backbone of DNA strands


Polymerase Chain Reaction Procedure

INITIAL STEP: 95°C for 2  minutes: The DNA double helix seperates, creating two single strands
Denature at 95°C for 30 seconds:  Any stray double helixes get broken down into single strands
Anneal at 57°C for 30 seconds: Primers attach to each end of the targeted DNA sequence before the DNA can recombine
Extend at 72°C for 30 seconds: The temperature activates the DNA polymerase that attaches to the primers and starts to add complimentary nucleotides until its reaches the end of the strand and falls off.
FINAL STEP: 72°C for 2
minutes
:
DNA polymerase is allowed ample time to complete adding nucleotides
FINAL HOLD: 4°C:  The chamber and DNA is cooled down


Base Pairing


Adenine(A): Thymine(T)
Thymine(T): Adenine(A)
Cytosine(C): Guanine(G)
Guanine(G): Cytosine(C)


The two steps of thermal cycling in with base-pairing occurs is Annealing and Extension. After Denaturing the DNA, making the double stranded DNA into single strands, the Annealing stage occurs. Lowering the temperature, the primers are then allowed to bind to their corresponding base pairs on the single stranded DNA. Raising the temperature again transitions the PCR process into the extension stage. In this stage the primers attached to the single stranded DNA extend with the help of Taq Polymerase, synthesizing new strands of DNA.

PCR Diagram

Reference: Polymerase Chain Reaction, Wikipedia, https://en.wikipedia.org/wiki/Polymerase_chain_reaction

SNP Information & Primer Design

Background: About the Disease SNP
Deoxyribonucleic Acid (DNA) is made up of single basic units called nucleotides which are composed of one nitrogenous base and a phosphate group that bonds each nucleotides together. Single nucleotide polymorphisms (SNPs), sometimes referred to as point mutations, are the most common type of genetic variation among people. A polymorphism is a DNA sequence difference that occurs when a single nucleotide in a sequence of DNA is replaced by a different nucleotide. For example, if the nucleotide Adenine (A) was replaced by Cytosine (C). These occur normally throughout a person's genome and most of them are harmless, however, sometimes they are essential biomarkers in helping scientists locate genes that are associated with a certain disease. Additionally, they can help predict an individual's response to a certain drug and overall, help personalize medicine to an individual's specific immune system.

The SNP rs1044498, found exclusively in the Homo sapiens species within the 6:131851228 chromosome, is closely related to the develpment of type 2 diabetes. The DNA sequence of rs1044498 can be accessed in the Ectonucleotide pyrophosphatase/phosphodiesterase 1 (EPPN1) gene that is primarily responsible for 3'-phosphoadenosine 5'-phosphosulfate binding, ATP binding, and NADH pyrophosphatase activity.


Reference: National Center for Biotechnology Information, https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=1044498


Primer Design and Testing The single nucleotide polymorphism rs1044498 is exactly located at the numerical position 131851228 which is encoded on the top strand of DNA displayed on the gene view. The non-disease codon is AAG has one nucleotide replaced which creates a mutation that as a result gives CAG as the disease's codon. In order to replicate the DNA, two primers are located on opposite ends and strands of the double helix. The non-disease forward primer is located 20 nucleotides to the left of the codon's position with a 20-base sequence (5'- TTCAGATGACTGCAAGGACA 3'). The non-disease reverse primer is located 200 nucleotides to the right of the codon's position at the numerical position of 131851428 with a 20-base sequence (5'- TGTTTAAAAGTTTCTTTAAT)

UCSC In-Silico PCR Results

Reference: UCSC In-Silico PCR Online Simulator, http://genome.ucsc.edu/cgi-bin/hgPcr?command=start