BME100 s2018:Group2 W1030 L4

BME 100 Spring 2018	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Aisha M Alsuwaidi Role(s) Name: Sarah Rosemary Davis Role(s) Name: Ian Conley Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never reuse disposable pipeeps tips. If you do, the samples will become cross-contaminated Cups for the discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G2 + Positive control none G2 - Negative control none G2 1-1 Patient 1, replicate 1 38066 G2 1-2 Patient 1, replicate 2 38066 G2 1-3 Patient 1, replicate 3 38066 G2 2-1 Patient 2, replicate 1 66318 G2 2-2 Patient 2, replicate 2 66318 G2 2-3 Patient 2, replicate 3 66318 DNA Sample Set-up Procedure First, place the extracted DNA into the PCR reaction tubes. Next, place the first primer into the PCR reaction tubes filled with the extracted DNA. Then, place the second primer into the PCR reaction tubes filled with extracted DNA. After that, add the nucleotides to the DNA mixture in the tubes. Finally, place the tubes into the thermal cycler. OpenPCR program The PCR program uses this thermal cycling procedure to replicate DNA strands. Heated Lid: 100 degrees Celsius Initial Step: 95 degrees Celsius for 2 minutes Number of Cycles: 25 Denature at 95 degrees Celsius for 30 seconds Anneal at 57 degrees Celsius for 30 seconds Extend at 72 degrees Celsius for 30 seconds Final Step: 72 degrees Celsius for 2 minutes Final Hold: 4 degrees Celsius This thermal cycle is repeated over and over, each time doubling the amount of DNA strands in the vial. Below is a image of a thermal cycling machine, taken from https://upload.wikimedia.org/wikipedia/commons/thumb/8/8e/PCR_machine.jpg/220px-PCR_machine.jpg Research and Development PCR - The Underlying Technology Template DNA Strand of DNA that is used as a template for new strands of DNA. This template is split into two strands and each one is copied using PCR. Primers Short single-stranded pieces of DNA that attach to the bonding sites on the template DNA. Nucleotides are added to the end of the primer along the DNA template to double the number of strands. Taq Polymerase Enzyme that adds nucleotides to the primer that are complimentary to the DNA template strand. Deoxyribonucleotides (dNTP's) Each nucleotide is either an Adenine, Thyamine, Cytosine, or Guanine (A,T,C,G, respectively). Nucleotides are added to the end of the primer such that As on the template strand attach to Ts added to the primer, Ts attach to As, Cs attach to Gs, and Gs attach to Cs. INITIAL STEP: 95°C for 2 minutes: The initial step separates the double-strand DNA into two single-strand during a PCR reaction. Denture at 95°C for 30 seconds: The denaturing causes the DNA double helix to unwind and separate into two single strands. Anneal at 57°C for 30 seconds: Annealing allows primer sequences to attach to each separated DNA strand at the correct site. Extend at 72°C for 30 seconds: At 72 degrees, DNA polymerase attaches to the primer and begins to add complimentary base pairs, extending the primer. FINAL STEP: 72°C for 2 minutes: Base pairs A T G and C can attach to the primer via DNA polymerase. FINAL HOLD: 4°C : Holds temperature at the end of the process to complete the cycle. After this hold is complete, another cycle can begin. Bonus Points Picture This image outlines the steps of PCR, taken from https://c1.staticflickr.com/8/7726/26915997226_d5bd0b7dc0_b.jpg. The first panel shows the template DNA strand. During the second panel, the template DNA strand undergoes denaturation, separating into two complimentary strands. In the third panel annealing happens, when the primer sequences attach to each of the separated strands of the template DNA strand. In the fourth panel DNA polymerase attaches to the primer and begins to extend the primer adding complimentary nucleotides. Once this is complete, the template DNA strands and completed strands are heated they separate and the process is repeated. Q3 Adenine pairs with Thymine; Thymine pairs with Adenine. Cytosine pairs with Guanine; Guanine pairs with Cytosine. Q4 Bair-pairing occurring during the final step of the thermal cycling, as well as the anneal at 57°C. SNP Information & Primer Design Background: About the Disease SNP DNA is formed by the joining of complimentary nucleotides that form a double helix. Adenine (A) always bonds with Thyamine (T), and Guanine (G) always bonds with Cytosine (C). Single nucleotide polymorphisms (SNPs) are changes of a single base pair in the DNA sequence. These SNPs have the ability to adversely affect the protein that is produced from that DNA sequence if its difference causes the complimentary RNA strand to code for a different amino acid. The SNP rs1044498 is found in humans (Homo sapiens) in the 6th chromosome. This SNP is related to the development of insulin resistance and Type 2 Diabetes. Ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) codes for a type 2 trans-membrane glycoprotein that has a number of uses. In particular it facilitates 3'-phosphoadenosine 5'-phosphosulfate binding, insulin receptor binding, and zinc ion binding. Mutations in this gene have been associated with the resistance to insulin in people with Type 2 diabetes. An allele is the specific form a DNA sequence takes. Multiple alleles are caused by mutations that have taken place at that point on the chromosome. In the non-disease allele of rs1044498, the codon is AAG. The disease-associated allele this SNP causes is a change to CAG. The numerical position of this SNP is 131851288. Primer Design and Testing The non-disease forward primer is 5'TTCAGATGACTGCAAGGACA The non-disease reverse primer is 5'TGTTTAAAAGTTTCTTTAAT The disease forward primer is 5'TTCAGATGACTGCAAGGACC The disease reverse primer is 5'TGTTTAAAAGTTTCTTTAAT Non-disease primer output: Disease primer output: