BioMicroCenter:RTPCR Protocol for Sample QC: Difference between revisions
(20 intermediate revisions by the same user not shown) | |||
Line 16: | Line 16: | ||
* Standard curve created using serial dilution of PhiX control DNA | * Standard curve created using serial dilution of PhiX control DNA | ||
* Standard curve must have a R^2 > 0.98 | * Standard curve must have a R^2 > 0.98 | ||
== Materials == | == Materials == | ||
* Enriched sample libraries (with either paired end or standard adapters) | * '''Enriched sample libraries (with either paired end or standard adapters)''' | ||
* Phix 335bp control library (Cat. No. CT-901-1001) | * '''Phix 335bp control library (Cat. No. CT-901-1001)''' | ||
* Qiagen Buffer EB | * '''Qiagen Buffer EB''' | ||
* Molecular biology grade water | * '''Molecular biology grade water''' | ||
* 10uM Forward Primer: AATGATACGGCGACCACCGA | * '''10uM Forward Primer: AATGATACGGCGACCACCGA''' | ||
* 10uM Reverse Primer: CAAGCAGAAGACGGCATACGA | * '''10uM Reverse Primer: CAAGCAGAAGACGGCATACGA''' | ||
* SYBR Green | * '''SYBR Green''' | ||
<span style="color: red">Roche LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)</span><br> | <span style="color: red">Roche LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)</span><br> | ||
Line 41: | Line 39: | ||
* '''LightCycler Plate''' | * '''LightCycler Plate''' | ||
<span style="color: | <span style="color: red">Roche LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001) and Sealing Foil</span><br> | ||
or<br> | or<br> | ||
<span style="color: | <span style="color: green">Axygen LightCycler 480 Multiwell Plate 96, White (Cat No. PCR-96-LC480-W) and Sealing Foil</span> | ||
== Preparing Standards == | == Preparing Standards == | ||
Line 66: | Line 61: | ||
* S7 – add 50uL of S6 to 50uL of EB (1:6400) | * S7 – add 50uL of S6 to 50uL of EB (1:6400) | ||
Vortex '''well''' and spin down in between each | Vortex '''well''' and spin down in between each dilution | ||
<span style="color: purple">Illumina Phix concentrations vary from lot to lot. It is recommended that you pool multiple tubes of Phix, separate them out into one time use aliquots (~2uL) and quantify one aliquot (we use the | <span style="color: purple">Illumina Phix concentrations vary from lot to lot. It is recommended that you pool multiple tubes of Phix, separate them out into one time use aliquots (~2uL) and quantify one aliquot (we use the KAPA Library Quantification kit for qPCR). This will allow you to have consistent concentrations across multiple preparations of your standards.</span> | ||
== Preparing Samples == | == Preparing Samples == | ||
* Dilute all samples to ~10nM with EB using previous quantification ( | * Dilute all samples to ~10nM with EB using previous quantification (Bioanalyzer or Qubit are recommended). | ||
* Create | * Create 1:1000 stocks of each sample by adding 1uL of a 10nM sample to 999uL of EB. If a sample is suspected to be highly concentrated based off of previous quantification, do a 1:10,000 dilution by adding 1uL sample to 99uL EB, then 1uL of the diluted stock to 99uL of EB again. | ||
* Make sure to vortex well and spin down each sample | * Make sure to vortex well and spin down each sample | ||
Line 86: | Line 81: | ||
Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells. | Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells. | ||
'''For 1 well:''' | '''For 1 well: Roche SYBR''' | ||
* Water – 3uL | * Water – 3uL | ||
Line 97: | Line 92: | ||
'''For | '''For 1 well: KAPA SYBR''' | ||
* | * Water – 7.2uL | ||
* PCR Primer | * PCR Primer Forward (P5), 10uM – 0.4uL | ||
* | * PCR Primer Reverse (P7), 10uM – 0.4uL | ||
* KAPA Sybr Fast – 10uL | |||
'''<span style="color: purple">Do not add SYBR Green to master mix until right before use</span> | '''<span style="color: purple">Do not add SYBR Green to master mix until right before use. Flick and spin down master mix after SYBR green has been added</span> | ||
''' | ''' | ||
Line 121: | Line 114: | ||
'''Plate set up:''' | '''Plate set up:''' | ||
* | * For Roche SYBR, add 5uL of samples and standards to appropriate wells | ||
* Add 5uL of EB to wells H11 and H12 for negative controls | * Add 5uL of EB to wells H11 and H12 for negative controls | ||
* Add 15uL of Master Mix | * Add 15uL of Master Mix to each well | ||
* Apply sealing foil | |||
* Briefly spin plate down <br> | |||
<br> | |||
* For KAPA SYBR Fast, add 2uL of samples and standards to appropriate wells | |||
* Add 2uL of EB to wells H11 and H12 for negative controls | |||
* Add 18uL of Master Mix to each well | |||
* Apply sealing foil | * Apply sealing foil | ||
* Briefly spin plate down | * Briefly spin plate down | ||
Line 130: | Line 129: | ||
# prepare the samples and incomplete master mix (containing everything but SYBR green) | # prepare the samples and incomplete master mix (containing everything but SYBR green) | ||
# On ice, plate all of the samples and standards | # On ice, plate all of the samples and standards | ||
# Add SYBR green to master mix and add | # Add SYBR green to master mix and then add complete master mix to all wells being used | ||
== RT-PCR Amplification Protocol == | == RT-PCR Amplification Protocol == | ||
On the LightCycler, we have found that running 30 cycles of amplification is sufficient for library quantification using the Roche SYBR Green (35 cycles for KAPA SYBR) | |||
* 72°C – 30 seconds | * Roche SYBR | ||
'''Activation:<br>''' | |||
95°C - 5 minutes<br> | |||
'''Amplification:<br>''' | |||
95°C – 5 seconds<br> | |||
60°C – 10 seconds <span style="color: red">The annealing temp can vary, depending on melting temperature of each primer</span><br> | |||
72°C – 30 seconds <br> | |||
'''Melting Curve:<br>''' | |||
95°C - 5 seconds<br> | |||
65°C - 1 minute<br> | |||
97°C<br> | |||
'''Cooling: <br>''' | |||
40°C - 30 seconds | |||
* KAPA SYBR | |||
'''Activation:<br>''' | |||
95°C - 5 minutes<br> | |||
'''Amplification:<br>''' | |||
95°C – 30 seconds<br> | |||
60°C – 45 seconds <span style="color: red">1-step annealing/extension</span><br> | |||
== Result Analysis == | == Result Analysis == | ||
When run is complete use standard | When run is complete use standard Cp (cycle number at which the amplification curve crosses the threshold) analysis for the machine being used. | ||
<span style="color: red">If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is | <span style="color: red">If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is to allow for a more stringent threshold for quantifying Illumina libraries.</span> | ||
Look over the amplification plots. If successful amplification has occurred you should see typical | Look over the amplification plots. If successful amplification has occurred you should see typical sinusoidal amplification for each plot. If the curves start below the 0 mark on the y-axis and appears to amplify around cycle 6, the sample is most likely too concentrated for the machine to accurately quantify the libraries. | ||
[[Image:BioMicro_Amp_graphs.jpg|700px]] | [[Image:BioMicro_Amp_graphs.jpg|700px]] | ||
===Calculate the Standard Curve:=== | ===Calculate the Standard Curve:=== | ||
* graph log concentration vs. | * graph log concentration vs. Cp of your standards: | ||
[[Image:BioMicroCenter_RTPCR_std1.jpg|400px]] | [[Image:BioMicroCenter_RTPCR_std1.jpg|400px]] | ||
Line 160: | Line 172: | ||
{|[[Image:BioMicro_Too_conc_ampl_plot.jpg|400px]]||[[Image:BioMicro_Standard_curve.jpg|400px|]]|} | {|[[Image:BioMicro_Too_conc_ampl_plot.jpg|400px]]||[[Image:BioMicro_Standard_curve.jpg|400px|]]|} | ||
* The | * The r^2 for the standard curve must be >0.98 or the RT-PCR should be repeated. Omit outliers as necessary. | ||
<span style="color: purple">If using standards prepared on a previous day compare the trend line equation to ensure that error has not been introduced</span><BR><BR> | <span style="color: purple">If using standards prepared on a previous day compare the trend line equation to ensure that error has not been introduced</span><BR><BR> | ||
===Calculate the Concentration of the Unknown Samples:=== | ===Calculate the Concentration of the Unknown Samples:=== | ||
* Use the standard curve equation to calculate the log concentration of your unknown samples (x = log concentration, y = | * Use the standard curve equation to calculate the log concentration of your unknown samples (x = log concentration, y = Cp determined by RT-PCR) | ||
* Solve the log to calculate the concentrations of the unknowns. Multiply the values calculated by | * Solve the log to calculate the concentrations of the unknowns. Multiply the values calculated by your dilution factor (typically 1000) to obtain the concentration of your sample. | ||
== Using RT-PCR Information to Improve Clustering == | == Using RT-PCR Information to Improve Clustering == | ||
We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto | We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto each flowcell for sequencing. We take these concentrations into account during the denaturation step of cluster generation. 2uL of a 10nM sample will be denatured in 6uL EB and 2uL of 0.5N NaOH for a final volume of 10uL. | ||
For samples that are under | For samples that are under 10nM: | ||
* | * Adjust sample:EB ratio to allow for proper loading concentration onto each flowcell. If samples are not concentrated enough, you may boil your samples at 98°C for 5min as an alternative to the sodium hydroxide denaturation. | ||
For samples over 20nM: | For samples over 20nM: | ||
* | * Dilute samples down to 10nM with EB and follow NaOH denaturation recipe above. |
Latest revision as of 06:54, 7 April 2011
HOME -- | SEQUENCING -- | LIBRARY PREP -- | HIGH-THROUGHPUT -- | COMPUTING -- | OTHER TECHNOLOGY |
![](https://s3-us-west-2.amazonaws.com/oww-files-thumb/7/79/BioMicroCenter-Cluster_numbers.png/600px-BioMicroCenter-Cluster_numbers.png)
This protocol is a slightly modified version of the protocol used at the Broad Institute. The original protocol was developed by Maura Costello. This protocol is similar to the one published in Nature Methods by Quail et al (2008) but uses SYBRgreen instead of Taqman probes.
Proof of Concept
Simultaneous test. Samples were tested for RT-PCR and clustered for sequencing on the same day. Their DNA concentration and the correlation of the concentration as measured by RT-PCR was then compared to their cluster number. All DNA samples had been thought to be at 10nM as determined by Qubit quantification.
Key Notes
- Use forward and reverse primers that match the 5' and 3' linkers used in the Illumina sample prep
- DO NOT FREEZE your samples between preforming RT-PCR and loading the cluster station (they can be left at 4°C for up to 24 hours).
- Standard curve created using serial dilution of PhiX control DNA
- Standard curve must have a R^2 > 0.98
Materials
- Enriched sample libraries (with either paired end or standard adapters)
- Phix 335bp control library (Cat. No. CT-901-1001)
- Qiagen Buffer EB
- Molecular biology grade water
- 10uM Forward Primer: AATGATACGGCGACCACCGA
- 10uM Reverse Primer: CAAGCAGAAGACGGCATACGA
- SYBR Green
Roche LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)
or
KAPA LightCycler 480 SYBR Fast Master Mix (Cat. No. KK4611)
- LightCycler Plate
Roche LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001) and Sealing Foil
or
Axygen LightCycler 480 Multiwell Plate 96, White (Cat No. PCR-96-LC480-W) and Sealing Foil
Preparing Standards
This procedure creates seven standards ranging from ~20nM to 0.3nM with which to create the standard curve. In preparing these standards 1:100 dilutions are created. After this step the standards are ready to use, they do not need to be diluted any further, and they can be kept at 4° for up to seven days.
- S1 – add 2uL of Phix control to 198uL of EB (1:100)
- S2 – add 50uL of S1 to 50uL of EB (1:200)
- S3 – add 50uL of S2 to 50uL of EB (1:400)
- S4 – add 50uL of S3 to 50uL of EB (1:800)
- S5 – add 50uL of S4 to 50uL of EB (1:1600)
- S6 – add 50uL of S5 to 50uL of EB (1:3200)
- S7 – add 50uL of S6 to 50uL of EB (1:6400)
Vortex well and spin down in between each dilution
Illumina Phix concentrations vary from lot to lot. It is recommended that you pool multiple tubes of Phix, separate them out into one time use aliquots (~2uL) and quantify one aliquot (we use the KAPA Library Quantification kit for qPCR). This will allow you to have consistent concentrations across multiple preparations of your standards.
Preparing Samples
- Dilute all samples to ~10nM with EB using previous quantification (Bioanalyzer or Qubit are recommended).
- Create 1:1000 stocks of each sample by adding 1uL of a 10nM sample to 999uL of EB. If a sample is suspected to be highly concentrated based off of previous quantification, do a 1:10,000 dilution by adding 1uL sample to 99uL EB, then 1uL of the diluted stock to 99uL of EB again.
- Make sure to vortex well and spin down each sample
Having a rough idea of the concentrations of your samples helps to avoid loading samples that are too concentrated for the RT-PCR machine to read.
Preparing Master Mix
Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells.
For 1 well: Roche SYBR
- Water – 3uL
- PCR Primer Forward (P5), 10uM – 1uL
- PCR Primer Reverse (P7), 10uM – 1uL
- Roche SYBR Green – 10uL
For 1 well: KAPA SYBR
- Water – 7.2uL
- PCR Primer Forward (P5), 10uM – 0.4uL
- PCR Primer Reverse (P7), 10uM – 0.4uL
- KAPA Sybr Fast – 10uL
Do not add SYBR Green to master mix until right before use. Flick and spin down master mix after SYBR green has been added
Master mix may vary depending on type of RT-PCR machine and brand of SYBR green being used
Plate Preparation
Lanes 4 through 10 can be used for additional samples or left empty
Plate set up:
- For Roche SYBR, add 5uL of samples and standards to appropriate wells
- Add 5uL of EB to wells H11 and H12 for negative controls
- Add 15uL of Master Mix to each well
- Apply sealing foil
- Briefly spin plate down
- For KAPA SYBR Fast, add 2uL of samples and standards to appropriate wells
- Add 2uL of EB to wells H11 and H12 for negative controls
- Add 18uL of Master Mix to each well
- Apply sealing foil
- Briefly spin plate down
We have found that the most effective way to load the plate is:
- prepare the samples and incomplete master mix (containing everything but SYBR green)
- On ice, plate all of the samples and standards
- Add SYBR green to master mix and then add complete master mix to all wells being used
RT-PCR Amplification Protocol
On the LightCycler, we have found that running 30 cycles of amplification is sufficient for library quantification using the Roche SYBR Green (35 cycles for KAPA SYBR)
- Roche SYBR
Activation:
95°C - 5 minutes
Amplification:
95°C – 5 seconds
60°C – 10 seconds The annealing temp can vary, depending on melting temperature of each primer
72°C – 30 seconds
Melting Curve:
95°C - 5 seconds
65°C - 1 minute
97°C
Cooling:
40°C - 30 seconds
- KAPA SYBR
Activation:
95°C - 5 minutes
Amplification:
95°C – 30 seconds
60°C – 45 seconds 1-step annealing/extension
Result Analysis
When run is complete use standard Cp (cycle number at which the amplification curve crosses the threshold) analysis for the machine being used.
If using LichtCycler 480 remember to change “High Confidence” to “High Sensitivity” in results page, this is to allow for a more stringent threshold for quantifying Illumina libraries.
Look over the amplification plots. If successful amplification has occurred you should see typical sinusoidal amplification for each plot. If the curves start below the 0 mark on the y-axis and appears to amplify around cycle 6, the sample is most likely too concentrated for the machine to accurately quantify the libraries.
Calculate the Standard Curve:
- graph log concentration vs. Cp of your standards:
- The r^2 for the standard curve must be >0.98 or the RT-PCR should be repeated. Omit outliers as necessary.
Calculate the Concentration of the Unknown Samples:
- Use the standard curve equation to calculate the log concentration of your unknown samples (x = log concentration, y = Cp determined by RT-PCR)
- Solve the log to calculate the concentrations of the unknowns. Multiply the values calculated by your dilution factor (typically 1000) to obtain the concentration of your sample.
Using RT-PCR Information to Improve Clustering
We utilize the concentrations obtained by RT-PCR to help better control the amount of sample that we are loading onto each flowcell for sequencing. We take these concentrations into account during the denaturation step of cluster generation. 2uL of a 10nM sample will be denatured in 6uL EB and 2uL of 0.5N NaOH for a final volume of 10uL.
For samples that are under 10nM:
- Adjust sample:EB ratio to allow for proper loading concentration onto each flowcell. If samples are not concentrated enough, you may boil your samples at 98°C for 5min as an alternative to the sodium hydroxide denaturation.
For samples over 20nM:
- Dilute samples down to 10nM with EB and follow NaOH denaturation recipe above.