Search results

From OpenWetWare
Jump to navigationJump to search
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)
  • 15.24 20.76 20.28 pos pos 90434 4.08 7.08 4.44 neg neg PM 9 90616 56.94 44.68 58.66 pos pos 91514 5.14 4.44 2.1 neg neg PM 10 74963 -1.08 -0.62 -0.93 neg...
    9 KB (0 words) - 04:26, 19 December 2013
  • 93 2.03 n 96210 n 1.67 1.94 2.06 n 12123 n 9.55 9.60 16.50 n 21312 n 10.50 11.50 13.50 nd 85002 pos 1.62 1.89 2.84 nd 34994 pos 0.72 0.94 1.01 nd 29341...
    7 KB (0 words) - 03:02, 22 March 2013
  • is a dimer with a Kd of ~ 100 µM. GFPmut2 - S65A, V68L, S72A [44] GFPmut3b - S65G, S72A [44] GFPmut3* - mutations from wt: S2R,S65G,S72A This is GFPmut3b...
    3 KB (864 words) - 07:15, 16 January 2013
  • 66 65 64 63 . . 192 191 190 189 . . . . . . . . 67 68 69 70 . . 193 194 195 196 . . . . . . . . 74 73 72 71 . . 200 199 198 197 . . . . . . . . 75 76 77...
    6 KB (521 words) - 14:36, 27 July 2006
  • 9.1rb, so use that instead) oligo 67 c5.0.22.2a ATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA ttt ggttggtgtggttgg oligo 67 c5.0.22.2b ACGGGTA (too short - don't...
    35 KB (134 words) - 20:28, 12 September 2006
  • (1989). 49. Lauffenburger, D.A., "A Simple Model for the Effects of Receptor-Mediated Cell/Substratum Adhesion on Cell Migration", Chem. Eng. Sci. 44, 1903-1914...
    50 KB (8 words) - 21:01, 13 December 2005
  • [43] ActivePerl [44] Perl Paraphernalia by Mark Jason Dominus [45] Coping with Scoping [46] Higher-Order Perl [47] Perl Circus [48] Regex [49] Hashes [50]...
    27 KB (1,648 words) - 03:07, 5 August 2008
  • (177210) CCG P 0.49 20.9 (76644) CAG Q 0.66 28.4 (104171) CGG R 0.11 5.9 (21552) ATT I 0.49 29.8 (109072) ACT T 0.19 10.3 (37842) AAT N 0.49 20.6 (75436) AGT...
    5 KB (49 words) - 19:52, 15 September 2014
  • 42 140 20 60 0 : Pole_occipital [43]: 43 220 180 20 0 : Pole_temporal [44]: 44 63 180 180 0 : S_calcarine [45]: 45 221 20 10 0 : S_central [46]: 46 21...
    4 KB (820 words) - 20:59, 13 July 2010
  • Orf-35 Orf-36 Orf-37 Orf-38 Orf-39 Orf-40 Orf-42 Orf-43 Orf-44 Orf-45 Orf-46 Orf-47 Orf-48 Orf-49 Orf-50 Orf-52 Orf-53 Orf-54 Orf-55 Orf-56 Orf-57 Orf-58 Orf-59...
    918 bytes (146 words) - 16:18, 13 June 2007
  • phenotypically diverse sequence data. Appl Environ Microbiol. 2006 May;72(5):3696-701. DOI:10.1128/AEM.72.5.3696-3701.2006 | PubMed ID:16672519 | HubMed [108] Tyo KE...
    29 KB (0 words) - 23:33, 21 April 2010
  • long-term adaptation in a changing environment. Phys. Rev. E 72:041922. doi:10.1103/PhysRevE.72.041922 C. O. Wilke, J. D. Bloom, D. A. Drummond, and A. Raval...
    32 KB (4,302 words) - 22:28, 16 December 2014
  • QR 43DH : CTAGCTGAGAGAGTCTGTCCTCTTTTGAGGAACAAGTTTTCTTGGGAGCAAAGTTTCCAT QR 44 : CATTGCCTTAAATTAATGCCGGAGAGGGTAGC QR 45DH : TATTTTTGAGAGATCTACAAAGGCTATC...
    25 KB (8 words) - 03:47, 25 October 2014
  • R. Engineering life: building a FAB for biology. Scientific American 294: 44-51 (2006). [30] 
 Isaacs FJ, Dwyer DJ and Collins JJ. RNA synthetic biology...
    18 KB (2,054 words) - 19:41, 28 September 2009
  • 070201 43 HTB82 A204 16 070201 44 HTB82 A204 16 070201 45 HTB82 A204 16 070201 46 K1E7neo 14 111007 47 K1E7neo 14 111007 48 49 HCT116p53+/+ 38 080107 50 T24...
    4 KB (126 words) - 02:09, 8 May 2013
  • culture tubes (VWR 60819-310) case 72 VWR Traceclean 20 ml vials with fluoropolymer resin/silicone septum VWR 15900-008 case 72 Nalgene boston round bottles...
    50 KB (7,646 words) - 15:59, 11 August 2011
  • Reddell 44 NFF rYB1 B9 270401 45 U2OS 230310 from Roger Reddell 46 U2OS 230310 from Roger Reddell 47 A1C6 191197 Hybridoma 48 A1C6 191197 Hybridoma 49 A1C6...
    3 KB (115 words) - 02:09, 8 November 2013
  • 66 HT1080 6CTG 160299 67 HT1080 6CTG 160299 68 HT1080 6CTG 160299 69 HT1080 6CTG 160299 70 HT1080 020709 71 JF-CF-61 T-1R 110507 72 293 210709 73 HT1080...
    4 KB (122 words) - 03:30, 22 June 2012
  • 050607 43 H24-H1299 6 050701 44 H24-H1299 45 H24-H1299 090201 46 GM2096/SV9 11 011101 47 GM2096/SV9 11 011101 48 HeLa 050607 49 HeLa 050607 50 HEPG2 P-- 24...
    3 KB (122 words) - 03:58, 28 March 2017
  • 210403 42 K1neo 300108 43 K1neo 300108 44 K1neo 300108 45 NHA 2 120905 46 47 K1-neo 30.01.08 48 T47D p11 030912 RPMI 49 MDA-MB231 P14 24.11.10 50 HF 12 191004...
    3 KB (121 words) - 22:15, 11 February 2013
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)