9,292
edits
BISC219/F12: RNAi Lab 7: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Colony PCR
Tucker Crum (talk | contribs) |
Tucker Crum (talk | contribs) |
||
| Line 59: | Line 59: | ||
#Obtain three PCR tubes and lids from your instructor in your team color. | #Obtain three PCR tubes and lids from your instructor in your team color. | ||
#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added. | #Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added. | ||
#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primer we are using is for T7 polymerase and we are only using one primer rather than two for this amplification. Why do we not need to use both a forward and reverse primer to detect the ''lys-2'' gene in this reaction? <BR>T7 | #Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primer we are using is for T7 polymerase and we are only using one primer rather than two for this amplification. Why do we not need to use both a forward and reverse primer to detect the ''lys-2'' gene in this reaction? <BR> | ||
'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - <br> | |||
5' TAATACGACTCACTATAGGG 3' | |||
| Line 68: | Line 69: | ||
#Snap the lid on the tubes, pulse them briefly in the microcentrifuge with the appropriate rotor and adapter and bring them to the thermal cycler for PCR initiation. | #Snap the lid on the tubes, pulse them briefly in the microcentrifuge with the appropriate rotor and adapter and bring them to the thermal cycler for PCR initiation. | ||
#Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''. | #Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''. | ||
<br><br> | <br><br> | ||
'''PCR Conditions:'''<br> | '''PCR Conditions:'''<br> | ||
