9,292
edits
BISC219/F12: RNAi Lab 7: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
→Colony PCR
Tucker Crum (talk | contribs) |
Tucker Crum (talk | contribs) |
||
| Line 59: | Line 59: | ||
#Obtain three PCR tubes and lids from your instructor in your team color. | #Obtain three PCR tubes and lids from your instructor in your team color. | ||
#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added. | #Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added. | ||
#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for | #Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for T7 polymerase. Why? T7 primer sequence:<BR> | ||
Forward 5’GAAATTAATACGACTCACTATAGG <BR> | Forward 5’GAAATTAATACGACTCACTATAGG <BR> | ||
Reverse 5’ CTTTAATTATGCTGATGATATCC | Reverse 5’ CTTTAATTATGCTGATGATATCC | ||
