Richard Lab:qPCR

Back to PCR protocols
Back to Protocols

Introduction

Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the qPCR hub page or the PCR hub page.

Equipment

• The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use. To access these systems you will need to in, and sign up on their calendar "CoreCal".
• To run your sample you'll need a 96 well optical plate with a half skirt (AB part #N801-0560) and an optical film to cover it. You can purchase these directly from the core facility.

DNA Preparation

• Your DNA can be extracted from any sample. We commonly use a kit for this purpose, but there are a variety of methods around to extract DNA from many materials.
• An important consideration is that the DNA is free of humic acids, which are common contaminants of dna extracted from soil or silage samples. Humic acids will screw up your qPCR.
• Typically 1-20ng of DNA will be added to each (20μL) reaction. This will generally involve diluting your DNA.

Primers

To design primers you should probably use a computer program. With the programs suggestions it is important to run a primer BLAST to check for non-specific binding. It is also important to make sure that their products are the same length if you're going to be comparing different populations using SYBR green. For considerations on how to choose which primers to use, see the analysis section. We use the following primers on a regular basis to identify specific populations:

• Quantification of total bacteria:
  • Ftot - GCAGGCCTAACACATGCAAGTC
  • Rtot - CTGCTGCCTCCCGTAGGAGT
• Quantification of Lactobacillus spp.
  • Flac - GCAGCAGTAGGGAATCTTCCA
  • Rlac - GCATTYCACCGCTACACATG
• Quantification of Ferulic acid esterase gene from Lactobacillus jonhsonii
  • Ffae - TTAAAACAGATCCGCATGTACGTAA
  • Rfae - AGCCCAGCTAACATTGAAGCA

PCR Mix

While there are many commercial 2X PCR mixes to choose from, a cheap and easy homemade stock is really useful for most applications.

2X SYBR Mix

This recipe is to make 1ml of 2X qPCR master mix using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.

• 705μL Water
• 200μL Thermopol Buffer (with Mg²⁺)
• 25μL dNTP mix (10mM each)
• 40μL ROX dye (see note)
• 10μL Taq DNA Polymerase (~15 units)
• 5μL each primer (100μM)
• 10μL SYBR Green II (100x)

Notes

• ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.
• If not using ROX (or using less ROX) substitute the remaining volume with water.

Taqman Mix

You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplicon length when doing comparisons.

Running the sample

1. Keep the master mix and your sample apart until immediately before running.

2. Dilute a portion of your samples to have a DNA concentration of 0.1-2ng/μL.

3. Place 10μL of the diluted samples in each well in the plate.

4. Lightly put the optical film over the plate.

5. Take your prepped plate and your 2X master mix (in a tube on ice) down to the core facility.

6. Start up the machine.

7. Set up the following program.

• Detector = SYBR, Rox = Yes (but only if you added it)
• 95°C for 10 min
  • 95°C for 20sec
  • 60°C for 60 sec
• Repeat the two-step cycle 45x
• If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
  • Ramp from 50.0°C to 95.0°C
  • Read every 0.2°C h
  • Hold 00:00:02 between reads

8. Add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier).

9. Quickly centrifuge the plate.

10. Place it in the machine and Run the program (you will need to save it first):

Analysis

• Comparative analysis of qPCR data is usually based on C_T (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).
• The threshold for C_T can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
• In general, the ratio between two C_T's in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different C_T's between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus: "In sample A, the C_T of population 1 is 2.5 higher than the C_T of population 2, but in the control sample the C_T's are nearly equal." The 2^-ΔΔC_T method allows us to more precisely quantify this change.

As Percentage of Total DNA

Using this method the C_T of a sample is compared to the C_T values of a standard curve of DNA from a pure culture.

• By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated.
• Results typically feel like, "There were 10ng of DNA added to this well, but the C_T is the same as the C_T of the well containg 1ng of pure culture DNA; so our target DNA is 10% of the total DNA".
• The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage). Often extra plant DNA can be extracted very differently from one sample to another. Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output.

Using the 2^-ΔΔC_T Method

This method uses a second set of primers which anneal to a greater population of DNA as an reference. This eliminates the vagueness of the total DNA method and the error introduced by differential DNA extraction.

• The amount of the target DNA relative to the reference DNA is 2^-ΔC_T where ΔC_T = ΔC_{T, target} - ΔC_{T, reference}.
• Typical output feels like "My population is 25% percent of the total bacterial population".
• You actually still have to make a standard curve (and sometimes more than one) for two reasons:

1. To be sure that your two primer pairs are amplifying at the same efficiency.

• The ΔC_T values should be approximately the same for all dilutions.
• This standard curve can be done with DNA from any sample and need not necessarilly be from a pure culture.

2. To calibrate the relationship between the two amplicons.

• If your comparing a one copy gene (like an enzyme) to a many copy gene (like rRNA genes) then a numerical relationship needs to be established between them.
• If your amplicons are different lengths then this will also be taken care of in this calibration.
• Sometimes it helps to use a DNA from pure cultures of different genera to determine this relationship if that's important to you.

Using the Pfaffl Method

• This is the prefered method as it corrects for differences in PCR efficiency as well as amplicon length without calibration.
• You should probably run a dilution just to see if your values jive.
• This method could be used to measure differential gene expression as well as comparative populations.

1. Definitions:

• Target - The population you're trying to quantify
• Reference - The population you're comparing it to
• Control - A treatment for which you are measuring both target and reference populations
• Sample - A treatment for which you are measuring both target and reference populations comparing to the control treatment

2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:

• Efficiency = E = 10^-1/slope.
• This is the major difference with the previous method, and corrects for differences in amplicon length as well as copy number.
• The slope of different dilutions (if you made any) should be the same.

3. Define the ΔCt for target and reference populations (the Pfaffl paper uses "CP" instead of Ct).

• ΔCt_target = Control Ct_target - Sample Ct_target.
• ΔCt_reference = Control Ct_reference - Sample Ct_reference.

4. Compare the sample to the control using the ΔCt's

• Ratio = (E_target)^ΔCt_target / (E_reference)^{ΔCt_reference}
• This is the ratio of the target in the sample to the target in the control, using the reaction effiency (E) and the reference levels to normalize.