IGEM:Stanford/2009/Project Homeostasis/sequences/SoxRS

From OpenWetWare
Jump to: navigation, search

<html> <style> /*----- General */ body {

 background: black;
 color: black;

} </style> </html>

  <html> <head> <style type="text/css";

           color:white; 
           font-style:italic;
           font-family:Arial;
          font-size: 1px;

>

</style> </head>

</html>


RBS – SoxR gene – Terminator – Spacer – SoxS Promoter

  • Sequence: length= 799

gaattcgcggccgcttctagagaaagaggagaaatactagATGGAAAAGAAATTACCCCGCATTAAAG CGCTGCTAACCCCCGGCGAAGTGGCGAAACGCAGCGGTGTGGCGGTATCGGCGCTGCAT TTCTATGAAAGTAAAGGGTTGATTACCAGTATCCGTAACAGCGGCAATCAGCGGCGATAT AAACGTGATGTGTTGCGATATGTTGCAATTATCAAAATTGCTCAGCGTATTGGCATTCCG CTGGCGACCATTGGTGAAGCGTTTGGCGTGTTGCCCGAAGGGCATACGTTAAGTGCGAAA GAGTGGAAACAGCTTTCGTCCCAATGGCGAGAAGAGTTGGATCGGCGCATTCATACCTTA GTGGCGCTGCGTGACGAACTGGACGGATGTATTGGTTGTGGCTGCCTTTCGCGCAGTGAT TGCCCGTTGCGTAACCCGGGCGACCGCTTAGGAGAAGAAGGTACCGGCGCACGCTTGCT GGAAGATGAACAAAACTAAtactagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttt cgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatata ctagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacaAATCGC TTTACCTCAAGTTAACTTGAGGAATTATACTCCCCAACAGATGAATTAACGAACTGctgcag

cggccgctactagta


  • Forward Primer: gtttcttcgaattcgcggccgcttctagaaagaggagaaatactagatgg
    • Length= 50 GC= 46% Melt= 66.7C


  • Reverse Primer: gtttcttcctgcagcggccgctactagtacagttcgttaattcatctgttggggag
    • Length= 56 GC= 50% Melt= 69.5C


<html> <head> <style type="text/css";

           color:white; 
           font-style:italic;
           font-family:Arial;
          font-size: 3px;
           

>

</style> </head>

</html>