IGEM:Stanford/2009/Project Homeostasis/sequences/Blh

From OpenWetWare
Jump to: navigation, search

<html> <style> /*----- General */ body {

 background: black;
 color: black;

} </style> </html>

  <html> <head> <style type="text/css";

           color:white; 
           font-style:italic;
           font-family:Arial;
          font-size: 1px;

>

</style> </head>

</html>



RBS - Blh gene

Sequence: length= 889

gaattcgcggccgcttctagagaaagaggagaaatactagATGGGTCTGATGCTGATTGATTGGTGTGCACTG GCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCGCTGGATGCTGCCATTTCTTTTTCTATGAT CTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTGCTGATCTATCTGCTGCTGGCGACCG CGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTGATCTTCCTGCTGATCTCCATT ATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAATGGCCGCATATCATCGC CCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTAACTAAACTGTTTA GCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTCCTGTGTTGG TCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCCTTTGA ACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTCTG CTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAA GATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTT CTTCCTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTGCAAACTGTGTTCATCGGTCTGGCGGC ACTGACCGTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATC

AAAAACTGActgcagcggccgctactagta


  • Forward Primer: gtttcttcgaattcgcggccgcttctagaaagaggagaaatactagatgggtctgatg
    • Length= 58 GC= 46.6% Melt= 68.2C


  • Reverse Primer: gtttcttcctgcagcggccgctactagtatcagtttttgattttgatacgggaagagtgcgg
    • Length= 62 GC= 48.4% Melt= 69.9C


<html> <head> <style type="text/css";

           color:white; 
           font-style:italic;
           font-family:Arial;
          font-size: 3px;
           

>

</style> </head>

</html>