Etchevers:Notebook/STRA6 in eye development/2009/08/01

From OpenWetWare
Jump to: navigation, search
C14.jpg Genetics of human eye development Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Choosing mouse primers for ChIP trials upon Nicolas' return

Amorces pour tester enrichissement de fragments après ChIP - souris

  • Typique pour FAIRE chez l'homme
  • Typiquement pas ressortissant par FAIRE

Synteny pour le chromosome 1 vaguement du début jusqu'à 60,000,000 c’est pareil que 90-150,000,000 sur le chromosome 4 de souris (Ensembl). Et de 160,000,000-210,000,000 c’est pareil que de 140,000,000 a la fin sur le chromosome 1 murin.

Si je BLAST une séquence du chr 1 humain elle s'aligne sur le chr 4 murin position 58,680K-63,140K comme attendu entre 4B3 et 4C1, beaucoup de petites séquences alignées.

La demande etait:

07-31 15:29 76HH15VW01N blastn Nucleotide Sequence (7158 letters) 7158 gpipe/10090/all_contig (expires) 08-02 03:29

Parmi les resultats,

ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomi... 1389

Mais il y en avait 96638 d'alignements!!

Parmi eux quelques sequences (et cela formatte tres mal, et je recois l'avertissement "WARNING: This page is 205 kilobytes long; some browsers may have problems editing pages approaching or longer than 32kb. Please consider breaking the page into smaller sections."

Si seulement je voyais comment preserver les retours chariots! >ref|NT_039260.7|Mm4_39300_37 Download subject sequence spanning the HSP Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323

Features flanking this part of subject sequence:
  7941 bp at 5' side: hypothetical protein LOC52829
  313973 bp at 3' side: multiple PDZ domain protein


Score = 1389 bits (1540),  Expect = 0.0
Identities = 2606/3795 (68%), Gaps = 40/3795 (1%)
Strand=Plus/Minus


Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484


Sbjct 20240169 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGTTACAGAAACAAGAC 20240110

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 20240109 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 20240050

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 20240049 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 20239990

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGC 2664

|

Sbjct 20239989 ATCCTAATATCTGATAAGATTGACTTCCAACCCAAAATCATCAAAAAAGACAAGGAGGGA 20239930

Query 2665 CATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATATAT 2724

| | | |

Sbjct 20239929 CACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCTAT 20239870

Query 2725 GCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG-AG 2782

| | | | |

Sbjct 20239869 GCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGCAC 20239812

Query 2783 ACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGACA 2842

| | |

Sbjct 20239811 ACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGACA 20239752

Query 2843 GATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCAAG 2902

| | |

Sbjct 20239751 GATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACAAA 20239692

Query 2903 CGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTTTT 2962

|

Sbjct 20239691 TGGATCTGACAGATATCTACAGAACATTTTTCCCTAAAACAAAAGGATATACCTTCTTCT 20239632

Query 2963 CAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCTCA 3022

|

Sbjct 20239631 CAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCTCA 20239572

Query 3023 GCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCAAA 3081

|

Sbjct 20239571 ACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAAGG 20239513

Query 3082 CTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAACA 3139

| |

Sbjct 20239512 CT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAACA 20239455

Query 3140 ACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTTCT 3199

| | |

Sbjct 20239454 ACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTTTT 20239395

Query 3200 TTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGCAG 3259

Sbjct 20239394 TAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGCAT 20239335

Query 3260 TGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAAAA 3319

| | | | |

Sbjct 20239334 TTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACATA 20239275

Query 3320 TTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAAAA 3378

| |

Sbjct 20239274 CTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAAGA 20239215

Query 3379 GCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACACAA 3438

| |

Sbjct 20239214 GG-AGTAGATGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAAGA 20239156

Query 3439 AAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAATT 3498

|

Sbjct 20239155 AGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGATA 20239096

Query 3499 GATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCAAT 3557

| | | | | |

Sbjct 20239095 GATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAAAT 20239037

Query 3558 AAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAGAG 3617

Sbjct 20239036 CAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAGAT 20238978

Query 3618 AATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATTCC 3677

|

Sbjct 20238977 CCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATTTC 20238918

Query 3678 TGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCAA 3737

Sbjct 20238917 TGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCCCA 20238858

Query 3738 TAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGGAC 3797

| | |

Sbjct 20238857 TATCACCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGGAC 20238798

Query 3798 CAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCTTC 3857

|

Sbjct 20238797 CAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCTGC 20238738

Query 3858 TGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGCCA 3917

Sbjct 20238737 ACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGCCA 20238678

Query 3918 GCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACCAA 3977

| | |

Sbjct 20238677 CTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACCAA 20238618

Query 3978 TATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCAGC 4037

Sbjct 20238617 TTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCAAG 20238558

Query 4038 AGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGCT 4097

| |

Sbjct 20238557 AACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGGAT 20238498

Query 4098 GGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAAAA 4157

|

Sbjct 20238497 GGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAAAA 20238438

Query 4158 ACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTTCA 4217

Sbjct 20238437 ACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATTCA 20238378

Query 4218 TGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGCTA 4277

| | | |

Sbjct 20238377 TGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGCAA 20238318

Query 4278 TCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTCTT 4337

| |

Sbjct 20238317 TCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCCAC 20238258

Query 4338 TGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTTGG 4397

| | |

Sbjct 20238257 TAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACTTG 20238198

Query 4398 AAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAAG 4457

| |

Sbjct 20238197 AAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAAAG 20238138

Query 4458 AGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCATTG 4517

Sbjct 20238137 AGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAAAA 20238078

Query 4518 TCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAAA 4577

|

Sbjct 20238077 ATTCTACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAAAA 20238018

Query 4578 TCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCAAA 4637

| |

Sbjct 20238017 TAAACTCAAACAAGTCAATGGCCTTTCTCTATACAAAGAATAAACAGGCTGAGAAAGAAA 20237958

Query 4638 TCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAA 4696

Sbjct 20237957 TTAGGGAAACAACACCC-TTCTCAATAGTCACAAATAATATAAAATATCTTGGCGTGACT 20237899

Query 4697 CTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAATA 4756

| | |

Sbjct 20237898 CTAACTAAGGAGGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAGAAATT 20237839

Query 4757 AAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATC 4816

| | |

Sbjct 20237838 AAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACATT 20237779

Query 4817 GTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCTA 4876

|

Sbjct 20237778 GTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAATT 20237719

Query 4877 CCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAG 4936

| | | | |

Sbjct 20237718 CCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACAAA 20237659

Query 4937 AGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCACAC 4994

| | |

Sbjct 20237658 AAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCACCA 20237601

Query 4995 TACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACC 5054

Sbjct 20237600 TGCCTGACCTAAAACTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTATA 20237541

Query 5055 AAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATATCT 5114

| | | |

Sbjct 20237540 GAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACACCT 20237481

Query 5115 ACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTAT 5174

| | |

Sbjct 20237480 ATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCATTT 20237421

Query 5175 TTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATCCC 5233

| | |

Sbjct 20237420 TCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATCCA 20237362

Query 5234 TTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGACCT 5293

| | |

Sbjct 20237361 TACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAACCA 20237302

Query 5294 AAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGGGC 5353

| |

Sbjct 20237301 GAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAGGG 20237242

Query 5354 AAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAATGG 5413

|

Sbjct 20237241 GAAAAATTCCTGAATAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAATGG 20237182

Query 5414 GATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAACAG 5472

| |

Sbjct 20237181 GACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAAAG 20237123

Query 5473 GCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAATA 5530

| | | |

Sbjct 20237122 ACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAATA 20237065

Query 5531 TCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCAAA 5590

|

Sbjct 20237064 TCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTAAA 20237005

Query 5591 AAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCAAC 5647

|

Sbjct 20237004 AAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAGAG 20236948

Query 5648 AGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACA 5707

Sbjct 20236947 AAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAACC 20236888

Query 5708 ATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAGG 5767

Sbjct 20236887 CTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCAGA 20236828

Query 5768 TGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAACTA 5827

| |

Sbjct 20236827 TGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGCTT 20236768

Query 5828 GTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATACCA 5887

| | |

Sbjct 20236767 GTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCG 20236708

Query 5888 TTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT-A 5946

| | | |

Sbjct 20236707 GAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGTAA 20236652

Query 5947 TAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGGAA 6006

| | |

Sbjct 20236651 GAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGGAA 20236592

Query 6007 CCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCAT 6066

|

Sbjct 20236591 AGAAACCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACAAT 20236532

Query 6067 GGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAA 6126

| |

Sbjct 20236531 GGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATGGA 20236472

Query 6127 ATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATATT 6186

| | | |

Sbjct 20236471 CCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATGTA 20236412

Query 6187 CTCACTCATAGGTGG 6201

Sbjct 20236411 CTCACTGATAAGTGG 20236397


Features flanking this part of subject sequence:
  30424 bp at 5' side: similar to major urinary protein 1
  42331 bp at 3' side: similar to major urinary protein 1


Score = 1379 bits (1528),  Expect = 0.0
Identities = 2606/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 257771 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 257712

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 257711 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 257652

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 257651 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 257592

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 257591 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 257534

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 257533 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 257474

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 257473 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 257416

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 257415 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 257356

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 257355 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 257296

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 257295 AATGGATCTGACAGATATCTAGAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 257236

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 257235 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 257176

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 257175 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 257117

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 257116 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 257059

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 257058 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 256999

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 256998 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 256939

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 256938 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 256879

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 256878 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 256819

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 256818 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 256760

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 256759 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 256700

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 256699 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 256641

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 256640 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 256582

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 256581 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 256522

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 256521 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 256462

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| |

Sbjct 256461 CATATCCCCTAAAGAAATAGTAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 256402

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 256401 ACCAGATGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 256342

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 256341 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 256282

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 256281 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 256222

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 256221 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 256162

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 256161 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 256102

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 256101 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 256042

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 256041 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 255982

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 255981 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 255922

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 255921 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 255862

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 255861 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 255802

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 255801 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 255742

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 255741 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 255682

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 255681 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 255622

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 255621 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 255562

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 255561 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 255503

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 255502 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 255443

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 255442 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 255383

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 255382 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 255323

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 255322 TTCCAACTCAATTCTTCAAGGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 255263

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 255262 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 255205

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 255204 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 255145

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 255144 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 255085

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

| |

Sbjct 255084 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 255025

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 255024 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 254966

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 254965 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 254906

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 254905 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 254846

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

| |

Sbjct 254845 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 254786

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

| |

Sbjct 254785 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 254727

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

| | | | |

Sbjct 254726 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 254669

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

| |

Sbjct 254668 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 254609

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

|

Sbjct 254608 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 254552

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

|

Sbjct 254551 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 254492

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

Sbjct 254491 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 254432

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

| | |

Sbjct 254431 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 254372

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

| | |

Sbjct 254371 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 254312

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

| | |

Sbjct 254311 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 254256

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

| | |

Sbjct 254255 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 254196

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

|

Sbjct 254195 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 254136

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

|

Sbjct 254135 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 254076

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

| | |

Sbjct 254075 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 254016

Query 6185 TTCTCACTCATAGGTGG 6201

Sbjct 254015 TACTCACTGATAAGTGG 253999


Features flanking this part of subject sequence:
  85416 bp at 5' side: hypothetical protein
  105101 bp at 3' side: nuclear factor I/B


Score = 1377 bits (1526),  Expect = 0.0
Identities = 2608/3798 (68%), Gaps = 46/3798 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 21466212 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 21466153

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 21466152 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 21466093

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 21466092 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 21466033

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 21466032 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 21465975

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 21465974 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 21465915

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 21465914 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 21465857

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 21465856 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 21465797

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 21465796 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 21465737

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 21465736 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 21465677

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 21465676 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 21465617

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 21465616 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 21465558

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 21465557 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 21465500

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 21465499 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 21465440

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 21465439 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 21465380

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 21465379 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 21465320

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 21465319 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 21465260

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 21465259 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 21465201

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 21465200 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 21465141

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 21465140 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 21465082

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 21465081 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 21465023

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 21465022 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 21464963

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 21464962 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 21464903

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 21464902 CATATCACCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 21464843

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 21464842 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 21464783

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 21464782 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 21464723

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 21464722 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 21464663

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 21464662 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 21464603

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| | |

Sbjct 21464602 AGAACACATTAAAGCGATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 21464543

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 21464542 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 21464483

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 21464482 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 21464423

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 21464422 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 21464363

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 21464362 AATCTACAGCAAACCAGTAGCAAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 21464303

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 21464302 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 21464243

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 21464242 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 21464183

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATAT-CTAGAAAACCCCA 4514

Sbjct 21464182 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATGCAAGTGACCCTAA 21464123

Query 4515 TTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACA 4574

| |

Sbjct 21464122 AAATTCCAACAGAGAA-CTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATA 21464064

Query 4575 AAATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCC 4634

| |

Sbjct 21464063 AAATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAG 21464004

Query 4635 AAATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATC 4693

|

Sbjct 21464003 AAATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTG 21463945

Query 4694 CAACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAA 4753

| | | |

Sbjct 21463944 ACTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAA 21463885

Query 4754 ATAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAAT 4813

| | |

Sbjct 21463884 ATTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAAC 21463825

Query 4814 ATCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAG 4873

|

Sbjct 21463824 ATTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAA 21463765

Query 4874 CTACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAA 4933

| | | | |

Sbjct 21463764 ATTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAAC 21463705

Query 4934 AAGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCA 4991

| | | | |

Sbjct 21463704 AAAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCA 21463647

Query 4992 CACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGT 5051

Sbjct 21463646 CCATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGT 21463587

Query 5052 ACCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATA 5111

| | | |

Sbjct 21463586 ATAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACA 21463527

Query 5112 TCTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCC 5171

|

Sbjct 21463526 CCTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCA 21463467

Query 5172 TATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGAT 5230

| | |

Sbjct 21463466 TTTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATTGAT 21463408

Query 5231 CCCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGA 5290

| | | | | |

Sbjct 21463407 CCATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAA 21463348

Query 5291 CCTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATG 5350

| | |

Sbjct 21463347 CCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACA 21463288

Query 5351 GGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAA 5410

| | |

Sbjct 21463287 GGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAA 21463228

Query 5411 TGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAA 5469

| |

Sbjct 21463227 TGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAA 21463169

Query 5470 CAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTA 5527

| | | | |

Sbjct 21463168 AAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTA 21463111

Query 5528 ATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATC 5587

|

Sbjct 21463110 ATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTT 21463051

Query 5588 AAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCC 5644

|

Sbjct 21463050 AAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCA 21462994

Query 5645 AACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACC 5704

Sbjct 21462993 GAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACA 21462934

Query 5705 ACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAAC 5764

|

Sbjct 21462933 ACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGC 21462874

Query 5765 AGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAA 5824

| |

Sbjct 21462873 AGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGG 21462814

Query 5825 CTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATA 5884

| | |

Sbjct 21462813 CTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTA 21462754

Query 5885 CCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGC 5944

| |

Sbjct 21462753 CCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGG 21462698

Query 5945 T-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTG 6003

| | |

Sbjct 21462697 TAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTG 21462638

Query 6004 GAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACAC 6063

|

Sbjct 21462637 GAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACAC 21462578

Query 6064 CATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGAT 6123

|

Sbjct 21462577 AATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGAT 21462518

Query 6124 GAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCAT 6183

| | |

Sbjct 21462517 GGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATAT 21462458

Query 6184 ATTCTCACTCATAGGTGG 6201

Sbjct 21462457 GTACTCACTGATAAGTGG 21462440


Features flanking this part of subject sequence:
  436814 bp at 5' side: tenascin C
  663356 bp at 3' side: pregnancy-associated plasma protein A


Score = 1373 bits (1522),  Expect = 0.0
Identities = 2610/3803 (68%), Gaps = 56/3803 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 3747063 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 3747122

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 3747123 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 3747182

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 3747183 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 3747242

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 3747243 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 3747300

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 3747301 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 3747360

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 3747361 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 3747418

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 3747419 ACACATTGCACCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 3747478

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 3747479 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 3747538

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

| |

Sbjct 3747539 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 3747598

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 3747599 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 3747658

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 3747659 CAACAGATGCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 3747717

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 3747718 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 3747775

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 3747776 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 3747835

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 3747836 TTTAGAGTTTAATGACAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 3747895

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 3747896 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 3747955

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 3747956 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 3748015

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 3748016 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 3748074

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 3748075 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 3748134

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 3748135 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 3748193

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 3748194 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 3748252

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 3748253 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 3748312

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 3748313 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 3748372

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 3748373 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 3748432

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 3748433 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 3748492

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 3748493 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 3748552

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 3748553 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 3748612

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 3748613 AATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCA 3748672

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 3748673 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 3748732

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 3748733 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 3748792

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 3748793 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 3748852

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 3748853 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 3748912

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 3748913 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 3748972

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 3748973 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 3749032

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 3749033 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 3749092

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 3749093 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 3749152

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 3749153 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 3749212

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 3749213 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 3749272

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 3749273 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 3749331

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 3749332 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 3749391

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 3749392 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 3749451

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 3749452 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 3749511

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 3749512 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 3749571

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 3749572 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 3749629

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 3749630 CATGCCTGACCTCAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 3749689

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 3749690 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 3749749

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

| |

Sbjct 3749750 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 3749809

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 3749810 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 3749868

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 3749869 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 3749928

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 3749929 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 3749988

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGC---AAC---AAAAGACAAAATTG 5405

| |

Sbjct 3749989 GGGAAAAATTCCTG-----AACA-GAACAGCAATGGCTTGTACTGTAAGATCGAGAATTG 3750042

Query 5406 ACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGA 5464

| |

Sbjct 3750043 ACAAATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA 3750102

Query 5465 GTGAACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAG 5522

| | | | |

Sbjct 3750103 -CAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGG 3750159

Query 5523 GGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACC 5582

|

Sbjct 3750160 GACTAATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACC 3750219

Query 5583 CCATCAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATG 5639

| |

Sbjct 3750220 CCCTTAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG 3750278

Query 5640 CAGCCAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCA 5699

| |

Sbjct 3750279 --GCAGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCA 3750336

Query 5700 AAACCACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAA 5759

Sbjct 3750337 AAACAACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTG 3750396

Query 5760 ACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACT 5819

| | |

Sbjct 3750397 ACAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATT 3750456

Query 5820 GTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGG 5879

| |

Sbjct 3750457 GCAGGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAG 3750516

Query 5880 AAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCAT 5939

| |

Sbjct 3750517 TACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCA 3750572

Query 5940 GCTGCT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAG 5998

| | |

Sbjct 3750573 ACTGGTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGA 3750632

Query 5999 ACTTGGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATA 6058

|

Sbjct 3750633 AACTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATC 3750692

Query 6059 TACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACA 6118

| |

Sbjct 3750693 TACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAA 3750752

Query 6119 TGGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACAC 6178

| | | |

Sbjct 3750753 TGGATGGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACAC 3750812

Query 6179 CGCATATTCTCACTCATAGGTGG 6201

|

Sbjct 3750813 AATATGTACTCACTGATAAGTGG 3750835


Features flanking this part of subject sequence:
  447385 bp at 5' side: solute carrier family 24 (sodium/potassium/calcium exchan...
  95043 bp at 3' side: myeloid/lymphoid or mixed lineage-leukemia translocation ...


Score = 1373 bits (1522),  Expect = 0.0
Identities = 2605/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 26953491 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 26953432

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 26953431 ACAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 26953372

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 26953371 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 26953312

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 26953311 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 26953254

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 26953253 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 26953194

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 26953193 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 26953136

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 26953135 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 26953076

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 26953075 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 26953016

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 26953015 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 26952956

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 26952955 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 26952896

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 26952895 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 26952837

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 26952836 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 26952779

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 26952778 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 26952719

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 26952718 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 26952659

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 26952658 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 26952599

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 26952598 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 26952539

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 26952538 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 26952480

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 26952479 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 26952420

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 26952419 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 26952361

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 26952360 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 26952302

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 26952301 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 26952242

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 26952241 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 26952182

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 26952181 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 26952122

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 26952121 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 26952062

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 26952061 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 26952002

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 26952001 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 26951942

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 26951941 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 26951882

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 26951881 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 26951822

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 26951821 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 26951762

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 26951761 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 26951702

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 26951701 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 26951642

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 26951641 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 26951582

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 26951581 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 26951522

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 26951521 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 26951462

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 26951461 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 26951402

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 26951401 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 26951342

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 26951341 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 26951282

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 26951281 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 26951223

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 26951222 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 26951163

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 26951162 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 26951103

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 26951102 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 26951043

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 26951042 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 26950983

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 26950982 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 26950925

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 26950924 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 26950865

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 26950864 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 26950805

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

|

Sbjct 26950804 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACACCAT 26950745

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 26950744 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 26950686

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 26950685 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 26950626

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 26950625 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 26950566

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

| |

Sbjct 26950565 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 26950506

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

| |

Sbjct 26950505 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 26950447

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

| | | | |

Sbjct 26950446 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 26950389

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

| |

Sbjct 26950388 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 26950329

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

|

Sbjct 26950328 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 26950272

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

|

Sbjct 26950271 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 26950212

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

Sbjct 26950211 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 26950152

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

| | |

Sbjct 26950151 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 26950092

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

| | |

Sbjct 26950091 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 26950032

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

| | |

Sbjct 26950031 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 26949976

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

| | |

Sbjct 26949975 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 26949916

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

|

Sbjct 26949915 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 26949856

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

|

Sbjct 26949855 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 26949796

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

| | |

Sbjct 26949795 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 26949736

Query 6185 TTCTCACTCATAGGTGG 6201

Sbjct 26949735 TACTCACTGATAAGTGG 26949719


(more in tomorrow's entry)

and that's not all.

So what does that mean? the sequence is a really, really common one at this level of identity? (Chr4 is the 4th, after equal similitude to parts of chr15 for example).

  • Heather 08:08, 1 August 2009 (EDT):