Etchevers:Notebook/STRA6 in eye development/2009/08/02

From OpenWetWare
Jump to: navigation, search
C14.jpg Genetics of human eye development Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

More BLAST sequences homologous to a region chosen from human chr 1

<html> <body> <tt> <br/> Features in this part of subject sequence: <br/>

  astrotactin 2 isoform a

<br/>

  astrotactin 2 isoform b


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2607/3802 (68%), Gaps = 54/3802 (1%)
Strand=Plus/Minus

<br/>

<br/> Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484 <br/>

               ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

<br/> Sbjct 5358753 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 5358694 <br/>

<br/> Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544 <br/>

               ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

<br/> Sbjct 5358693 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 5358634 <br/>

<br/> Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604 <br/>

               || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

<br/> Sbjct 5358633 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 5358574

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

               |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 5358573 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 5358516

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

               | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 5358515 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 5358456

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

               |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 5358455 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 5358398

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

               | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 5358397 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 5358338

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

               |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 5358337 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 5358278

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

               |  ||| || | ||| |||||||||||  |  | || ||| ||| || |||||| || ||

Sbjct 5358277 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 5358218

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 5358217 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 5358158

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

               || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 5358157 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 5358099

Query 3080 AACTAGAACTCAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAAC 3138

                 |||    |||  |  || | |  | ||  ||| ||   ||   || ||||||||||||

Sbjct 5358098 GGCTAATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACGTGGAAACTGAAC 5358040

Query 3139 AACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTTC 3198

               |||   || || |||||   || |||  |  | | ||| |||  |||||| ||    || 

Sbjct 5358039 AACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTTT 5357980

Query 3199 TTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGCA 3258

               || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | ||||||

Sbjct 5357979 TTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGCA 5357920

Query 3259 GTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAAA 3318

                |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  | 

Sbjct 5357919 TTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACAT 5357860

Query 3319 ATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAAA 3377

               | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  ||| 

Sbjct 5357859 ACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAAG 5357800

Query 3378 AGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACACA 3437

               ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || |||  

Sbjct 5357799 AGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAAG 5357741

Query 3438 AAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAAT 3497

               || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| ||

Sbjct 5357740 AAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGAT 5357681

Query 3498 TGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCAA 3556

                |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   ||

Sbjct 5357680 AGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAAA 5357622

Query 3557 TAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAGA 3616

               | | ||| ||| || || || || || ||  ||||   |||||| ||||  |||||||||

Sbjct 5357621 TCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAGA 5357563

Query 3617 GAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATTC 3676

                  | |||||||   || ||| |||  ||||| ||||| || || |||||||| ||||| 

Sbjct 5357562 TCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATTT 5357503

Query 3677 CTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCA 3736

               ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || || 

Sbjct 5357502 CTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCCC 5357443

Query 3737 ATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGGA 3796

               ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || ||||||

Sbjct 5357442 ATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGGA 5357383

Query 3797 CCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCTT 3856

               ||||| ||||| |  || || ||||| ||||  | ||| || || ||    ||| | || 

Sbjct 5357382 CCAGACGGATTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCTG 5357323

Query 3857 CTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGCC 3916

               |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| |||

Sbjct 5357322 CACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGCC 5357263

Query 3917 AGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACCA 3976

               |  || | ||||||||| || |||   | |||  ||||||| | |||||| || ||||||

Sbjct 5357262 ACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACCA 5357203

Query 3977 ATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCAG 4036

               || ||  | |||||||| || |||||||| || |||||||  || || ||  ||||||| 

Sbjct 5357202 ATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCAA 5357143

Query 4037 CAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGC 4096

                | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| || 

Sbjct 5357142 GAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGGA 5357083

Query 4097 TGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAAA 4156

               ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  ||||||||||

Sbjct 5357082 TGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAAA 5357023

Query 4157 AACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTTC 4216

               ||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || |||

Sbjct 5357022 AACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATTC 5356963

Query 4217 ATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGCT 4276

               ||| ||||| ||||  | | || ||| ||| | ||    ||  | || || |||| ||| 

Sbjct 5356962 ATGATAAAAGCTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGCA 5356903

Query 4277 ATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTCT 4336

               |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || | 

Sbjct 5356902 ATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCCA 5356843

Query 4337 TTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTTG 4396

                | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  | 

Sbjct 5356842 CTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACTT 5356783

Query 4397 GAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAA 4456

               |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | ||||||

Sbjct 5356782 GAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAAA 5356723

Query 4457 GAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCATT 4516

               |||||||||||| | || || |||||||| || ||||| |||||| ||    |||| |  

Sbjct 5356722 GAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAAA 5356663

Query 4517 GTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAA 4576

                  ||  ||  | | ||||| || ||||||| || |||| |  ||||  | ||||| |||

Sbjct 5356662 AATTCCACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAAA 5356603

Query 4577 ATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCAA 4636

               || ||   | | || |||   ||  |  | ||||| || || | |||  | ||||   ||

Sbjct 5356602 ATTAACTCAAACAAGTCAATGGCCCTTCTCTACACAAAGAATAAACAGGCTGAGAAAGAA 5356543

Query 4637 ATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCA 4695

               || |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |   

Sbjct 5356542 ATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGAC 5356484

Query 4696 ACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAAT 4755

                || || | ||| ||||| |  || |   |  | |||| |||  | |||   || |||||

Sbjct 5356483 TCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAAT 5356424

Query 4756 AAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATAT 4815

                ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| ||

Sbjct 5356423 TAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACAT 5356364

Query 4816 CGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCT 4875

                || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  |

Sbjct 5356363 TGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAAT 5356304

Query 4876 ACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAA 4935

                ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | ||

Sbjct 5356303 TCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACAA 5356244

Query 4936 GAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCACA 4993

                | | |    || || ||  |  | ||  | |  ||||||||    |||| || ||||| 

Sbjct 5356243 AAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCACC 5356186

Query 4994 CTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTAC 5053

                | |||||| | || || |||||||  || |  || |  ||||| |||||||||||||| 

Sbjct 5356185 ATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTAT 5356126

Query 5054 CAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATATC 5113

                 | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | |

Sbjct 5356125 AGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACACC 5356066

Query 5114 TACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTA 5173

               ||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | | 

Sbjct 5356065 TATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCATT 5356006

Query 5174 TTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATCC 5232

               || || || ||||||||| | |||||| | |  || ||||||||   ||  | | |||||

Sbjct 5356005 TTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATTGATCC 5355947

Query 5233 CTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGACC 5292

                | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | |||

Sbjct 5355946 ATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAACC 5355887

Query 5293 TAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGGG 5352

                 | ||  | |||    |||| || || || || |  | | || | || || ||||  ||

Sbjct 5355886 AGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAGG 5355827

Query 5353 CAAGGACTTCATGTCTAAAACACCAAAAGCAATGGC---AAC---AAAAGACAAAATTGA 5406

                 |  | ||| ||     ||||  || |||||||||    ||   || |   | ||||||

Sbjct 5355826 GGAAAAATTCCTG-----AACA-GAACAGCAATGGCTTGTACTGTAAGATCGAGAATTGA 5355773

Query 5407 CAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAG 5465

               ||||||||| ||||| |||||  | || |||||||  |||||||| |||  | || ||| 

Sbjct 5355772 CAAATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA- 5355714

Query 5466 TGAACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGG 5523

                 || || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  ||

Sbjct 5355713 CAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGG 5355656

Query 5524 GCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCC 5583

                ||||||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||

Sbjct 5355655 ACTAATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCC 5355596

Query 5584 CATCAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGC 5640

               | | ||||| ||||     ||  |||||| | | ||||||    | ||| ||    ||| 

Sbjct 5355595 CCTTAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG- 5355538

Query 5641 AGCCAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAA 5700

                ||  | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||

Sbjct 5355537 -GCAGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAA 5355479

Query 5701 AACCACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAA 5760

               ||| ||  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  |

Sbjct 5355478 AACAACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGA 5355419

Query 5761 CAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTG 5820

               || ||| |||||| ||||||||||||||| ||||||| |  | || ||||||||||| ||

Sbjct 5355418 CAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTG 5355359

Query 5821 TAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGA 5880

                |  || || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | 

Sbjct 5355358 CAGGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGT 5355299

Query 5881 AATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATG 5940

               | ||||    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   

Sbjct 5355298 ACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAA 5355243

Query 5941 CTGCT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGA 5999

               ||| | | || ||||||||| |   |||||| || || || ||||| | |||||| |  |

Sbjct 5355242 CTGGTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAA 5355183

Query 6000 CTTGGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATAT 6059

                 |||||  |||||| ||| |   |||     || |||||  ||||||||||| |||| |

Sbjct 5355182 ACTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCT 5355123

Query 6060 ACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACAT 6119

               |||| ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | ||

Sbjct 5355122 ACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAAT 5355063

Query 6120 GGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACC 6179

               ||||| |  |||| | |||||| || ||| |  || | |||  |||||  | |  |||| 

Sbjct 5355062 GGATGGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACA 5355003

Query 6180 GCATATTCTCACTCATAGGTGG 6201

                 || | |||||| ||| ||||

Sbjct 5355002 ATATGTACTCACTGATAAGTGG 5354981


Features flanking this part of subject sequence:
  1016884 bp at 5' side: tripartite motif protein 32
  192001 bp at 3' side: toll-like receptor 4


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2604/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

               ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 5925480 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 5925421

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

               ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 5925420 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 5925361

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

               || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 5925360 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 5925301

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

               |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 5925300 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 5925243

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

               | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 5925242 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 5925183

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

               |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 5925182 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 5925125

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

               | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 5925124 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 5925065

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

               |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 5925064 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 5925005

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

               |  ||| || | ||| |||||||||||  |  |||| ||| ||| || |||||| || ||

Sbjct 5925004 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 5924945

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 5924944 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAAACAGGCCT 5924885

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

               || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 5924884 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 5924826

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                 || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 5924825 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 5924768

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

               ||||   || || |||||   || |||  |  | | ||| |||  |||||| ||    ||

Sbjct 5924767 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 5924708

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 5924707 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 5924648

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

               | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 5924647 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 5924588

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 5924587 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 5924528

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 5924527 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 5924469

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 5924468 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 5924409

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

               | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 5924408 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 5924350

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

               || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 5924349 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 5924291

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

               |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 5924290 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 5924231

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 5924230 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 5924171

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 5924170 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 5924111

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

               |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 5924110 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 5924051

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 5924050 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 5923991

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

               ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 5923990 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 5923931

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

               ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 5923930 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 5923871

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                 | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 5923870 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 5923811

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 5923810 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 5923751

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

               |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 5923750 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 5923691

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

               |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 5923690 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 5923631

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 5923630 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 5923571

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                 | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 5923570 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 5923511

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 5923510 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 5923451

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

               ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 5923450 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 5923391

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                   ||   |  | | ||||| ||  |||||| || |||| |  ||||  | ||||| ||

Sbjct 5923390 AAATTCCAACAGAGAACTCCTAAACTTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 5923331

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

               ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 5923330 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 5923271

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

               ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 5923270 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 5923212

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                 || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 5923211 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 5923152

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

               | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 5923151 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 5923092

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

               | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 5923091 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 5923032

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

               | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 5923031 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 5922972

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

               | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 5922971 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 5922914

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                 | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 5922913 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 5922854

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                  | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 5922853 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 5922794

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

               |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 5922793 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 5922734

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||||

Sbjct 5922733 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 5922675

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

               | | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | ||

Sbjct 5922674 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 5922615

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

               |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 5922614 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 5922555

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

               |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 5922554 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 5922495

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

               |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 5922494 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 5922436

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

               || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 5922435 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 5922378

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

               ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 5922377 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 5922318

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

               |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 5922317 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 5922261

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

               | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 5922260 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 5922201

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

               |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 5922200 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 5922141

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

               | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 5922140 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 5922081

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

               | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 5922080 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 5922021

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

               |    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   ||| |

Sbjct 5922020 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 5921965

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 5921964 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 5921905

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

               ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 5921904 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 5921845

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

               ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 5921844 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 5921785

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 5921784 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 5921725

Query 6185 TTCTCACTCATAGGTGG 6201

               | |||||| ||| ||||

Sbjct 5921724 TACTCACTGATAAGTGG 5921708


Features flanking this part of subject sequence:
  641758 bp at 5' side: hypothetical protein
  173772 bp at 3' side: hypothetical protein LOC66928


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2605/3797 (68%), Gaps = 45/3797 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

                ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 14374681 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 14374740

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

                ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 14374741 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 14374800

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

                || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 14374801 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 14374860

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

                |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 14374861 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 14374918

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

                | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 14374919 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 14374978

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

                |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 14374979 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 14375036

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

                | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 14375037 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 14375096

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

                |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 14375097 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 14375156

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

                |  ||| || | ||| |||||||||||  |  |||| ||| ||| || |||||| || ||

Sbjct 14375157 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 14375216

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                 |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 14375217 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 14375276

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

                || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 14375277 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 14375335

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                  || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 14375336 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 14375393

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

                ||||   || || |||||   || |||  |  | | ||| |||  | || |||||   ||

Sbjct 14375394 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAAAATTAAAGACTTT 14375453

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                 || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 14375454 -TTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 14375512

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

                | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 14375513 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 14375572

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                 | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 14375573 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 14375632

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                 ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 14375633 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 14375691

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                 || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 14375692 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 14375751

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

                | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 14375752 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 14375810

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

                || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 14375811 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 14375869

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

                |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 14375870 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 14375929

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                 ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 14375930 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 14375989

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                 ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 14375990 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 14376049

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

                |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 14376050 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 14376109

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                 |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 14376110 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 14376169

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

                ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 14376170 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 14376229

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

                ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 14376230 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 14376289

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                  | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 14376290 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 14376349

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                 ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 14376350 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 14376409

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

                |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 14376410 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 14376469

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

                |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 14376470 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 14376529

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                 |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 14376530 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 14376589

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                  | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 14376590 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 14376649

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                 |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 14376650 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 14376709

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

                ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 14376710 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 14376769

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                    ||   |  | | ||||| || ||||||| || |||| |  ||||  | ||||| ||

Sbjct 14376770 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 14376829

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

                ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 14376830 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 14376889

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

                ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 14376890 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 14376948

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                  || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 14376949 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 14377008

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

                | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 14377009 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 14377068

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

                | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 14377069 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 14377128

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

                | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 14377129 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 14377188

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

                | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 14377189 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 14377246

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 14377247 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 14377306

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 14377307 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 14377366

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

                |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 14377367 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 14377426

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                 || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||||

Sbjct 14377427 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 14377485

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

                | | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | ||

Sbjct 14377486 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 14377545

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

                |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 14377546 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 14377605

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

                |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 14377606 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 14377665

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

                |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 14377666 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 14377724

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

                || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 14377725 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 14377782

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

                ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 14377783 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 14377842

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

                |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 14377843 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 14377899

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

                | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 14377900 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 14377959

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

                |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 14377960 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 14378019

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

                | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 14378020 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 14378079

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

                | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 14378080 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 14378139

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

                |    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   ||| |

Sbjct 14378140 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 14378195

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                 | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 14378196 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 14378255

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

                ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 14378256 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 14378315

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

                ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 14378316 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 14378375

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                 |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 14378376 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 14378435

Query 6185 TTCTCACTCATAGGTGG 6201

                | |||||| ||| ||||

Sbjct 14378436 TACTCACTGATAAGTGG 14378452


Features flanking this part of subject sequence:
  647409 bp at 5' side: hypothetical protein LOC66928
  15526 bp at 3' side: protein tyrosine phosphatase, receptor type, D isoform B


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2604/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

                ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 15203951 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 15203892

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

                ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 15203891 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 15203832

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

                || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 15203831 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 15203772

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

                |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 15203771 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 15203714

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

                | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 15203713 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 15203654

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

                |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 15203653 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 15203596

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

                | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 15203595 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 15203536

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

                |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 15203535 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 15203476

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

                |  ||| || | ||| |||||||||||  |  |||| ||| ||| || |||||| || ||

Sbjct 15203475 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 15203416

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                 |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 15203415 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 15203356

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

                || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 15203355 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 15203297

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                  || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 15203296 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 15203239

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

                ||||   || || |||||   || |||  |  | | ||| |||  |||||| ||    ||

Sbjct 15203238 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 15203179

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                 || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 15203178 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 15203119

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

                | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 15203118 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 15203059

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                 | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 15203058 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 15202999

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                 ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 15202998 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 15202940

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                 || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 15202939 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 15202880

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

                | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 15202879 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 15202821

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

                || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 15202820 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 15202762

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

                |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 15202761 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 15202702

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                 ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 15202701 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 15202642

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                 ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 15202641 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 15202582

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

                |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 15202581 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 15202522

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                 |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 15202521 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 15202462

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

                ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 15202461 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 15202402

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

                ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 15202401 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 15202342

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                  | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 15202341 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 15202282

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                 ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 15202281 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 15202222

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

                |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 15202221 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 15202162

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

                |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 15202161 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 15202102

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                 |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 15202101 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 15202042

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                  | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 15202041 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 15201982

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                 |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 15201981 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 15201922

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

                ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 15201921 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 15201862

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                    ||   |  | | ||||| || ||||||| || |||| |  ||||  | ||||| ||

Sbjct 15201861 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 15201802

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

                ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 15201801 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 15201742

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

                ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 15201741 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 15201683

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                  || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 15201682 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 15201623

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

                | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 15201622 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 15201563

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

                | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 15201562 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 15201503

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

                | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 15201502 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 15201443

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

                | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 15201442 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 15201385

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 15201384 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 15201325

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 15201324 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 15201265

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

                |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 15201264 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 15201205

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                 || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||||

Sbjct 15201204 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 15201146

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

                | | | |  | |||| ||| ||  |||| || |  ||||| || ||     || | | ||

Sbjct 15201145 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACCTCACATAAAAC 15201086

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

                |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 15201085 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 15201026

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

                |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 15201025 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 15200966

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

                |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 15200965 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 15200907

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

                || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 15200906 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 15200849

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

                ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 15200848 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 15200789

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

                |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 15200788 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 15200732

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

                | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 15200731 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 15200672

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

                |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 15200671 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 15200612

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

                | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 15200611 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 15200552

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

                | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 15200551 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 15200492

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

                |    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   ||| |

Sbjct 15200491 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 15200436

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                 | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 15200435 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 15200376

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

                ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 15200375 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 15200316

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

                ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 15200315 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 15200256

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                 |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 15200255 GACCTGGAGAGCATCATCCTGAGTGAGTTAACACAATCACAAAGGAACTCACACAATATG 15200196

Query 6185 TTCTCACTCATAGGTGG 6201

                | |||||| ||| ||||

Sbjct 15200195 TACTCACTGATAAGTGG 15200179


Features flanking this part of subject sequence:
  931606 bp at 5' side: protein tyrosine phosphatase, receptor type, D isoform A
  856861 bp at 3' side: hypothetical protein


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2604/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

                ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 16339407 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 16339466

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

                ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 16339467 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 16339526

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

                || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 16339527 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 16339586

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

                |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 16339587 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 16339644

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

                | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 16339645 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 16339704

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

                |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 16339705 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 16339762

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

                | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 16339763 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 16339822

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

                |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 16339823 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 16339882

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

                |  ||| |||| ||| |||||||||||  |  | || ||| ||| || |||||| || ||

Sbjct 16339883 AATGGATCTAACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 16339942

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                 |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 16339943 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 16340002

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

                || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 16340003 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 16340061

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                  || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 16340062 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 16340119

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

                ||||   || || |||||   || |||  |  | | ||| |||  |||||| ||    ||

Sbjct 16340120 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 16340179

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                 || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 16340180 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 16340239

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

                | |    ||||||||| | ||||| |||| ||||  || ||  || | ||| ||| |  |

Sbjct 16340240 ATTTCTAAGAGGGAAACTCATAGCTCTGAGTGCCTCCATGAAGAAACGGGAGAGAGCACA 16340299

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                 | |  || | | ||| ||||| ||||||  ||||||||  | || |||||  ||  |||

Sbjct 16340300 TACTAGCAGCTTGACAACACAACTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 16340359

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                 ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 16340360 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 16340418

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                 || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 16340419 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 16340478

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

                | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 16340479 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 16340537

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

                || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 16340538 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 16340596

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

                |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 16340597 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 16340656

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                 ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 16340657 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 16340716

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                 ||| |       ||||| |  ||| | || |||||  |   | ||||||| || |||||

Sbjct 16340717 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCTGAGCCAAAAAAAGCCCAGG 16340776

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

                |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 16340777 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 16340836

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                 |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 16340837 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 16340896

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

                ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 16340897 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 16340956

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

                ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 16340957 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 16341016

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                  | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 16341017 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 16341076

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                 ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 16341077 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 16341136

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

                |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 16341137 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 16341196

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

                |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 16341197 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 16341256

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                 |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 16341257 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 16341316

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                  | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 16341317 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 16341376

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                 |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 16341377 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 16341436

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

                ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 16341437 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 16341496

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                    ||  ||  | | ||||| || ||||||| || |||| |  ||||  | ||||| ||

Sbjct 16341497 AAATTCTACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 16341556

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

                ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 16341557 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 16341616

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

                ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 16341617 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 16341675

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                  || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 16341676 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 16341735

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

                | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 16341736 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 16341795

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

                | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 16341796 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 16341855

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

                | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 16341856 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 16341915

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

                | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 16341916 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 16341973

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 16341974 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 16342033

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 16342034 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 16342093

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

                |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 16342094 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 16342153

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                 || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||||

Sbjct 16342154 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 16342212

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

                | | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | ||

Sbjct 16342213 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 16342272

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

                |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 16342273 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 16342332

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

                |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 16342333 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 16342392

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

                |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 16342393 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 16342451

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

                || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 16342452 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 16342509

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

                ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 16342510 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 16342569

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

                |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 16342570 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 16342626

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

                | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 16342627 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 16342686

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

                |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 16342687 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 16342746

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

                | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 16342747 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 16342806

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

                | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 16342807 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 16342866

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

                |    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   ||| |

Sbjct 16342867 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 16342922

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                 | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 16342923 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 16342982

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

                ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 16342983 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 16343042

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

                ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 16343043 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 16343102

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                 |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 16343103 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 16343162

Query 6185 TTCTCACTCATAGGTGG 6201

                | |||||| ||| ||||

Sbjct 16343163 TACTCACTGATAAGTGG 16343179


Features flanking this part of subject sequence:
  42184 bp at 5' side: hypothetical protein
  18552 bp at 3' side: hypothetical protein


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2604/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

                ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 21318084 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 21318143

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

                ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 21318144 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 21318203

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

                || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 21318204 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 21318263

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

                |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 21318264 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 21318321

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

                | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 21318322 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 21318381

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

                |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 21318382 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 21318439

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

                | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 21318440 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 21318499

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

                |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 21318500 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 21318559

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

                |  ||| || | ||| |||||||||||  |  |||| ||| ||| || |||||| || ||

Sbjct 21318560 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 21318619

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                 |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 21318620 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 21318679

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

                || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 21318680 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 21318738

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                  || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 21318739 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 21318796

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

                ||||   || || |||||   || |||  |  | | ||| |||  |||||| ||    ||

Sbjct 21318797 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 21318856

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                 || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 21318857 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 21318916

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

                | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 21318917 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 21318976

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                 | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 21318977 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 21319036

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                 ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 21319037 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 21319095

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                 || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 21319096 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 21319155

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

                | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 21319156 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 21319214

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

                || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 21319215 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 21319273

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

                |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 21319274 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 21319333

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                 ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 21319334 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 21319393

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                 ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 21319394 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 21319453

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

                |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 21319454 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 21319513

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                 |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 21319514 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 21319573

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

                ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 21319574 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 21319633

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

                ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 21319634 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 21319693

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                  | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 21319694 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 21319753

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                 ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 21319754 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 21319813

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

                |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 21319814 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 21319873

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

                |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 21319874 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 21319933

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                 |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 21319934 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 21319993

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                  | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 21319994 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 21320053

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                 |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 21320054 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 21320113

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

                ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 21320114 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 21320173

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                    ||   |  | | ||||| || ||||||| || |||| |  ||||  | ||||| ||

Sbjct 21320174 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 21320233

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

                ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 21320234 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 21320293

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

                ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 21320294 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 21320352

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                  || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 21320353 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 21320412

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

                | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 21320413 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 21320472

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

                | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 21320473 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 21320532

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

                | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 21320533 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 21320592

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

                | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 21320593 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 21320650

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 21320651 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 21320710

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 21320711 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 21320770

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

                |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 21320771 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 21320830

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                 || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||||

Sbjct 21320831 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 21320889

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

                | | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | ||

Sbjct 21320890 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 21320949

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

                |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 21320950 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 21321009

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

                |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 21321010 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 21321069

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

                |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 21321070 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 21321128

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

                || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 21321129 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 21321186

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

                ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 21321187 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 21321246

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

                |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 21321247 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 21321303

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

                | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 21321304 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 21321363

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

                |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 21321364 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 21321423

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

                | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 21321424 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 21321483

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

                | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 21321484 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 21321543

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

                |    || ||||| || ||  | || || ||||| ||| | ||    |   |   ||| |

Sbjct 21321544 CGGAGGATCCAGCAATACCTCTCCTAGGCATATATCCAGAAGA----AGCCCCAACTGGT 21321599

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                 | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 21321600 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 21321659

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

                ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 21321660 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 21321719

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

                ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 21321720 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 21321779

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                 |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 21321780 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 21321839

Query 6185 TTCTCACTCATAGGTGG 6201

                | |||||| ||| ||||

Sbjct 21321840 TACTCACTGATAAGTGG 21321856


Features in this part of subject sequence:
  hypothetical protein LOC230393


Score = 1370 bits (1518),  Expect = 0.0
Identities = 2604/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

                ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 27637477 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 27637536

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

                ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 27637537 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 27637596

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

                || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 27637597 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 27637656

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

                |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 27637657 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 27637714

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

                | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 27637715 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 27637774

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

                |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 27637775 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 27637832

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

                | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 27637833 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 27637892

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

                |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 27637893 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 27637952

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

                |  ||| || | ||| |||||||||||  |   ||| ||| ||| || |||||| || ||

Sbjct 27637953 AATGGATCTGACAGATATCTACAGAACATTTTTCCCTAAAACAAAAGGATATACCTTCTT 27638012

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                 |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 27638013 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 27638072

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

                || || ||  ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 27638073 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 27638131

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                  || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 27638132 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 27638189

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

                ||||   || || |||||   || |||  |  | | ||| |||  |||||| ||    ||

Sbjct 27638190 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 27638249

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                 || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 27638250 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 27638309

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

                | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 27638310 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 27638369

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                 | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 27638370 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 27638429

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                 ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 27638430 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 27638488

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                 || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 27638489 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 27638548

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

                | |||| |||  |||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 27638549 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 27638607

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

                || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 27638608 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 27638666

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

                |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 27638667 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 27638726

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                 ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 27638727 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 27638786

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                 ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 27638787 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 27638846

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

                |||||| || || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 27638847 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 27638906

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                 |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 27638907 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 27638966

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

                ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 27638967 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 27639026

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

                ||| ||  | |||||||| || |||||||| || |||||||  || || ||  |||||||

Sbjct 27639027 AATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCA 27639086

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

                  | ||||| |||    | ||||| | ||| ||||| || || || || |||||||| ||

Sbjct 27639087 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 27639146

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

                 ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||||

Sbjct 27639147 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 27639206

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

                |||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || ||

Sbjct 27639207 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 27639266

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

                |||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |||

Sbjct 27639267 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 27639326

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

                 |||||   ||||||   |||||| |||| | | |||||  | || ||||||||| || |

Sbjct 27639327 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 27639386

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

                  | ||| | || || ||||| || ||||| || || ||   ||| |||||||||||  |

Sbjct 27639387 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 27639446

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

                 |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||||

Sbjct 27639447 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 27639506

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

                ||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| | 

Sbjct 27639507 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 27639566

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

                    ||   |  | | ||||| || ||||||| || |||| |  ||||  | ||||| ||

Sbjct 27639567 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 27639626

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

                ||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||   |

Sbjct 27639627 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 27639686

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

                ||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |  

Sbjct 27639687 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 27639745

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

                  || || | ||| ||||| |  || |   |  | |||| |||  | |||   || ||||

Sbjct 27639746 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 27639805

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

                | ||||| |||   |  | ||||||  |  | |||||||||||| | || || | ||| |

Sbjct 27639806 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 27639865

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

                | || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||  

Sbjct 27639866 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 27639925

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

                | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  | |

Sbjct 27639926 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 27639985

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

                | | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||||

Sbjct 27639986 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 27640043

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

                  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||||

Sbjct 27640044 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 27640103

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

                   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || | 

Sbjct 27640104 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 27640163

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

                |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   | |

Sbjct 27640164 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 27640223

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

                 || || || ||||||||| | |||||| | |  || ||||||||   ||  | ||||||

Sbjct 27640224 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATGGATC 27640282

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

                | | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | ||

Sbjct 27640283 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 27640342

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

                |  | ||  | |||    |||| || || || || |  | | || | || || ||||  |

Sbjct 27640343 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 27640402

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

                |  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||||

Sbjct 27640403 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 27640462

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

                |||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   || 

Sbjct 27640463 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 27640521

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

                || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||||

Sbjct 27640522 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 27640579

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

                ||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| | |

Sbjct 27640580 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 27640639

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

                |||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||  

Sbjct 27640640 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 27640696

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

                | |  ||| |||||||||| ||| ||||  |   |||||| ||||||||||||||||| |

Sbjct 27640697 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 27640756

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

                |  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| ||

Sbjct 27640757 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 27640816

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

                | |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || |  |

Sbjct 27640817 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 27640876

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

                | || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |||

Sbjct 27640877 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 27640936

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

                |    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   ||| |

Sbjct 27640937 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 27640992

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

                 | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |||

Sbjct 27640993 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 27641052

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

                ||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||| 

Sbjct 27641053 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 27641112

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

                ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||||

Sbjct 27641113 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 27641172

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

                 |  |||| | |||||| || ||| |  || | |||  |||||  | |  ||||   || 

Sbjct 27641173 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 27641232

Query 6185 TTCTCACTCATAGGTGG 6201

                | |||||| ||| ||||

Sbjct 27641233 TACTCACTGATAAGTGG 27641249


Features flanking this part of subject sequence:
  400561 bp at 5' side: tenascin C
  699609 bp at 3' side: pregnancy-associated plasma protein A


Score = 1368 bits (1516),  Expect = 0.0
Identities = 2606/3799 (68%), Gaps = 48/3799 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

               ||||| || ||  | ||||| |||||||| |||||| |||| ||| || | |  ||||||

Sbjct 3714582 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 3714523

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

               ||| || | |||||  | |||||||| ||||||| |   | ||| | |||    |||| |

Sbjct 3714522 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 3714463

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

               || || || ||||  |  || | ||||||||| || |   | ||| | ||||| || || 

Sbjct 3714462 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 3714403

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

               |||||| | |||||||| |  |||||  ||||  |||||  ||||||| |||||| || |

Sbjct 3714402 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 3714345

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

               | || | |||  |  | || ||   ||| |  ||||| || ||  | || || ||||| |

Sbjct 3714344 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 3714285

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

               |||| || |||||| ||||| | | ||||| ||||| || |  | ||| |    ||||| 

Sbjct 3714284 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 3714227

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

               | || | |   | |||||| ||||| |||||||||| ||||| ||||| ||| || | ||

Sbjct 3714226 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 3714167

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

               |||||||  || ||||||| | |||| ||| || | | || | |    ||   || | ||

Sbjct 3714166 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 3714107

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

               |  ||| || | ||| |||||||||||  |  | || ||| ||| || |||||| || ||

Sbjct 3714106 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 3714047

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

                |||||||| ||    |||| ||||||||||||||||||| | ||    ||| ||  |||

Sbjct 3714046 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 3713987

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

               || || ||| ||||  |  |||||| |  ||   |||| | ||||| |||  |||| | |

Sbjct 3713986 CAACAGATGCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 3713928

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

                 || || || ||  |  || | |  | ||  ||| ||   ||   ||||||||||||||

Sbjct 3713927 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 3713870

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

               ||||   || || |||||   || |||  |  | ||||| |||  |||||| ||    ||

Sbjct 3713869 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGAAATAAAGAAAGAAATTAAAGACTT 3713810

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

                || ||    ||||| ||  ||| |||||| ||||  || || |||||  || | |||||

Sbjct 3713809 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 3713750

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

               | |    ||||||||| | |||||  ||| ||||  ||||| ||| | ||| ||| |  |

Sbjct 3713749 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 3713690

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

                | |  || | | ||| ||||  ||||||  ||||||||  | || |||||  ||  |||

Sbjct 3713689 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 3713630

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

                ||  || ||| || | |||||||  ||| |||| |  ||| | ||  || | || ||| 

Sbjct 3713629 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 3713571

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

                || |||  |||||| ||||||  || | ||||| ||||| ||||| |  || ||||| |

Sbjct 3713570 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 3713511

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

               | |||| |||   ||| ||||| | |||||   | | | || || |  | |||  |   |

Sbjct 3713510 TAGATAAACCCTCAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 3713452

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

               || | ||| ||| || || || || || ||  ||||   |||||| ||||  ||||||||

Sbjct 3713451 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 3713393

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

               |   | |||||||   || ||| |||  ||||| ||||| || || |||||||| |||||

Sbjct 3713392 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 3713333

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

                ||||||| ||||    | ||||   | || |||||  |||||||   ||| || || ||

Sbjct 3713332 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 3713273

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

                ||| |       ||||| |  ||| | || |||||  | ||| ||||||| || |||||

Sbjct 3713272 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 3713213

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

               ||||||  | || |  || || ||||| ||||  | ||| || || ||    ||| | ||

Sbjct 3713212 ACCAGACAGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 3713153

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

                |  ||||| || ||    ||||||  ||| || || || || |||||||||||||| ||

Sbjct 3713152 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 3713093

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

               ||  || | ||||||||| || |||   | |||  ||||||| | |||||| || |||||

Sbjct 3713092 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 3713033

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

               ||| ||  | |||||||| || ||||||||||| |||||||  || || ||  |||||||

Sbjct 3713032 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 3712973

Query 4036 GCAGCACATCAAAAAGC--TTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAA 4093

                 || ||||   |||||  | ||||| | ||| ||||| || || || || |||||||| 

Sbjct 3712972 --AGAACATATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAG 3712915

Query 4094 GGCTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGAC 4153

               || ||||| |||||||| ||||| || |||||||||||  ||| ||||| |  |||||||

Sbjct 3712914 GGATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGAC 3712855

Query 4154 AAAAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCC 4213

               |||||||||||||| |||||  |||||||||||||||| |||||||| || ||||| || 

Sbjct 3712854 AAAAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCA 3712795

Query 4214 TTCATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGA 4273

               |||||| |||||  |||  | | || ||| ||| | ||    ||  | || || |||| |

Sbjct 3712794 TTCATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAA 3712735

Query 4274 GCTATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTC 4333

               || |||||   ||||||   |||||| |||| | | |||||  | || |||||| || ||

Sbjct 3712734 GCAATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAACAATC 3712675

Query 4334 TCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTG 4393

                |  | ||| | || || ||||| || ||||| || || ||   ||| ||||||||||| 

Sbjct 3712674 CCACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTA 3712615

Query 4394 TTGGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGA 4453

                | |||||  | ||||| |||||| | ||  | ||||| || ||||| || ||| | |||

Sbjct 3712614 CTTGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGA 3712555

Query 4454 AAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCC 4513

               ||||||||||||||| | || || |||||||| || ||||| |||||| ||    |||| 

Sbjct 3712554 AAAGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCT 3712495

Query 4514 ATTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATAC 4573

               |     ||   |  | | ||||| || ||||||| || |||| |  ||||  | ||||| 

Sbjct 3712494 AAAAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATAT 3712435

Query 4574 AAAATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGC 4633

               ||||| ||   | | || |||   || ||  | ||||| || || | |||  | ||||  

Sbjct 3712434 AAAATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAA 3712375

Query 4634 CAAATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAAT 4692

                |||| |  ||   ||| ||| ||| |||| ||  |||| |  |||||||| || ||  |

Sbjct 3712374 GAAATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGT 3712316

Query 4693 CCAACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGA 4752

                   || || | ||| ||||| |  || |   |  | |||| |||| |||||   || ||

Sbjct 3712315 GACTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAGA 3712256

Query 4753 AATAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAA 4812

               ||| ||||| |||   |  | ||||||  |  | |||||||||||| | || || | |||

Sbjct 3712255 AATTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAA 3712196

Query 4813 TATCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAA 4872

                || || |||||||| ||  | |  || | ||| |||||||||||||| |||||||| ||

Sbjct 3712195 CATTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAA 3712136

Query 4873 GCTACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCA 4932

                 | ||||     |||||||  ||| | |||  | | | ||  || ||||| |||||  |

Sbjct 3712135 AATTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAA 3712076

Query 4933 AAAGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATC 4990

                || | | |    || || ||  |  | ||  | |  ||||||||    |||| || |||

Sbjct 3712075 CAAAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATC 3712018

Query 4991 ACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGG 5050

               ||  | |||||| | || || |||||||  || |  || |  ||||| ||||||||||||

Sbjct 3712017 ACCATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGG 3711958

Query 5051 TACCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCAT 5110

               ||   | ||||| |  | || |||||||| ||||  |    | ||||||| |  || || 

Sbjct 3711957 TATAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACAC 3711898

Query 5111 ATCTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCC 5170

               | |||     |  ||||||| |||||    | ||||| ||  || |||   || ||   |

Sbjct 3711897 ACCTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGC 3711838

Query 5171 CTATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGA 5229

                | || || || ||||||||| | |||||| | |  || ||||||||   ||  | | ||

Sbjct 3711837 ATTTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGA 3711779

Query 5230 TCCCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAG 5289

               ||| | | |  | |||| ||| ||  |||| || |  ||||| || ||  |  || | | 

Sbjct 3711778 TCCATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGATCTTCACATAAA 3711719

Query 5290 ACCTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCAT 5349

               |||  | ||  | |||    |||| || || || || |  | | || | || || |||| 

Sbjct 3711718 ACCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCAC 3711659

Query 5350 GGGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAA 5409

                ||  |  | ||| ||   | |||| |||  ||    ||   || |   | |||||||||

Sbjct 3711658 AGGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAA 3711599

Query 5410 ATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGA 5468

               |||||| ||||| |||||  | || |||||||  |||||||| |||  | || |||   |

Sbjct 3711598 ATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAA 3711540

Query 5469 ACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCT 5526

               | || | ||| ||| | ||||| |  || ||| |  | ||||   ||| || |  || ||

Sbjct 3711539 AAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACT 3711482

Query 5527 AATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCAT 5586

               ||||||||  || || || ||||||||  |  |  ||   | |||| |||| |||||| |

Sbjct 3711481 AATATCCAACATATATAAAGAACTCAAGAAGGTGGACTTCAGAAAATCAAATAACCCCCT 3711422

Query 5587 CAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGC 5643

                ||||| ||||     ||  |||||| | | ||||||    | ||| ||    |||  ||

Sbjct 3711421 TAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GC 3711365

Query 5644 CAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAAC 5703

                 | |  ||| |||||||||| ||| ||||  |   |||||| |||||||||||||||||

Sbjct 3711364 AGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAAC 3711305

Query 5704 CACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAA 5763

                ||  |||||| ||| ||||||||||| |||||||| |  || ||||| |||||  ||| 

Sbjct 3711304 AACCCTGAGATTCCACCTCACACCAGTCAGAATGGCTAAGATCAAAAATTCAGGTGACAG 3711245

Query 5764 CAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAA 5823

               ||| |||||| ||||||||||||||| ||||||| |  | || ||||||||||| || | 

Sbjct 3711244 CAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAG 3711185

Query 5824 ACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAAT 5883

                || || |||||| | ||||| ||||| ||||| ||||||||  |  | ||  | | | |

Sbjct 3711184 GCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACT 3711125

Query 5884 ACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTG 5943

               |||    || ||||| || ||  | ||||| ||||| ||| | ||    |   |   |||

Sbjct 3711124 ACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTG 3711069

Query 5944 CT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTT 6002

                | | || ||||||||| |   |||||| || || || ||||| | |||||| |  |  |

Sbjct 3711068 GTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACT 3711009

Query 6003 GGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACA 6062

               ||||  |||||| ||| |   |||     || |||||  ||||||||||| |||| ||||

Sbjct 3711008 GGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACA 3710949

Query 6063 CCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGA 6122

               | ||||| |||||  |||| || |||||  |||| || |||   ||  |||  | |||||

Sbjct 3710948 CAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGA 3710889

Query 6123 TGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCA 6182

               || |  ||||   |||||| || ||| |  || | |||  |||||  | |  ||||   |

Sbjct 3710888 TGGACCTGGAGGGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATA 3710829

Query 6183 TATTCTCACTCATAGGTGG 6201

               | | |||||| ||| ||||

Sbjct 3710828 TGTACTCACTGATAAGTGG 3710810

</tt> </body> </html>

  • Heather 08:12, 1 August 2009 (EDT):