BME100 s2017:Group9 W8AM L4

BME 100 Spring 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Emma Spencer Name: Aswathy Lawrence Name: Jocelyn Alvar Name: Brett Nasch Name: Anna Seminara Name: Will Anderson LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL each DNA/ primer mix, 8 tubes, 50 μL each A strip of empty PCR tubes Disposable pipette tips Cup for discarded tips Micropipettor OpenPCR machine PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G9 + Positive control none G9 - Negative control none G9 1-1 Patient 1, replicate 1 37823 G9 1-2 Patient 1, replicate 2 37823 G9 1-3 Patient 1, replicate 3 37823 G9 2-1 Patient 2, replicate 1 49958 G9 2-2 Patient 2, replicate 2 49958 G9 2-3 Patient 2, replicate 3 49958 DNA Sample Set-up Procedure Move DNA samples into PCR tubes Add primer 1 to the PCR tubes with the DNA samples in them Add the primer 2 to the tubes Add nucleotides to the PCR tubes Add DNA Polymerase to the PCR tubes Move PCR tubes into a DNA Thermal Cycler and heat at 95°C for 2 minutes Allow thermal cycler to cool to 57°C for 30 seconds Change the temperature on the cycler to 72°C to activate DNA Polymerase for 30 seconds Lower temperature to 50°C Raise temperature to 72°C to stimulate DNA Polymerase Repeat the steps 25 times to produce billions of copies of the DNA fragment OpenPCR program Image 1 Image 2 HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD 4°C Thermal Cycling is a process that rapidly heats and cools DNA in order to allow primers to bind to the DNA strand in a specific region (1) and then polymerase replicates the DNA in the area (2). At the end of the process the desired area of the DNA has been replicated many times and it is much easier to get a comprehensive analysis of the DNA. This process can be used for DNA fingerprinting to match small fragments of DNA that has been found to the whole DNA strand of suspects. Research and Development PCR - The Underlying Technology Component functions of the PCR reaction A template DNA strand is used as a model for the newly synthesized strand of DNA. It contains the genes that are to be copied into the new strand. DNA primers are used to indicate the starting point of DNA replication. The Taq polymerase enzyme will recognize and bind to primers on the template DNA strand and then begin replication. The enzyme Taq polymerase binds to the primed sequences of DNA and adds nucleotides to extend the second strand. The deoxyribonucleotides are the monomers of a DNA strand, containing a nitrogenous base, deoxyribose sugar and a phosphate group. Taq polymerase synthesizes these nucleotides to grow the replicated DNA strand. The deoxyribonucleotides bind to each other through complementary base pairing. What happens to the components (listed above) during each step of thermal cycling? The first step of PCR is applying heat and raising the temperature to 95°C for 3 minutes. This simply heats up the solution. During the second step, or denaturing at 95°C for 30 seconds, the strands of the template DNA split up. The third step is lowering the temperature to 57°C for 30 seconds, which allows the primers to bind to the complimentary target sequence. The next step is to raise the temperature slightly to 72°C for 30 seconds, which is when the taq polymerase attaches to the primers. The last step is to hold the 72°C for 3 minutes, which is when the taq polymerase arranges nucleotides to make a new DNA sequence. The final hold at 4°C stops the reaction until the next run. Which DNA base pair anneals to each base There are four nucleotides, and they are thymine, adenine, guanine, and cytosine, or T, A, G, and C, respectively. T and A correspond, and C and G correspond. So when the taq polymerase is making its way along a DNA strand replicating, it comes accross each of these nucleotides. Whent he polymerase reads a T, it places an A on the new strand. When it reads a C, it places a G on the new strand. When it reads an A, it places a T. And lastly, when it reads a G, it places a C. During which two steps of thermal cycling does base-pairing occur? Base-pairing occurs during the third and fourth steps of thermal cycling. It occurs initially when the Taq polymerase enzyme adds DNA nucleotides to the replicated strand after it has bonded to the primer sequence of DNA. Base-pairing then continues to occur when the PCR cycle is repeated through 35 cycles, creating billions of replicated DNA strands. Name: Steps of PCR Image source: https://www.ncbi.nlm.nih.gov/probe/docs/techpcr/ SNP Information & Primer Design Background: About the Disease SNP SNPs are single nucleotide pairs that are unique for each individual. These differences in the DNA strands are only one nucleotide different than everyone else but they are undetectable by the naked eye. These changes alter how humans react to drugs and the strength of their reaction. Primer Design and Testing A nucleotide is a monomer unit that is the building blocks for the DNA and RNA, that consists of a base, sugar molecule, and a phosphate. A polymorphism is when multiple phenotypes subsist in the same population of species. The rs121908757 is found in homo sapiens. The chromosome is located on 7:117587799. The clinical significance of this SNP is that it is pathogenic. The condition liked to this SNP is mutation spectrum in Jewish cystic fibrosis patients, and severe cardiac failure. CFTR stands for cystic fibrosis trans-membrane conductance regulator. The function of CFTR is that it is a channel for the movement of chloride ions in and out of cells, which is important for the salt and water balance on the surface of organs. An allele are variations of a gene, resulting in different traits. The disease associated allele contains the codon is GCG. The numerical position of the primer is 117587799. Non-disease forward primer: 5’- ​AGAAGGTGGAATCACACTGA - 3’ Numerical position 200 bases to the right is 117587999 Non-disease reverse primer: 5’ - CATTATTTATAGTTCTTAAA - 3’ Disease forward primer: 5’ - AGAAGGTGGAATCACACTGT - 3’ Disease reverse primer: 5’ - ACAGTGTGATTCCACCTTCT - 3’ Nondisease disease