OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl2
, and dNTP’s
(http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorl
ess-master-mix-m714-protocol/)
- DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you
do, the samples will become cross-contaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G1 + |
Positive control |
none
|
| G1 - |
Negative control |
none
|
| G1 1-1 |
replicate 1 |
65580
|
| G1 1-2 |
replicate 2 |
65580
|
| G1 1-3 |
replicate 3 |
65580
|
| G1 2-1 |
replicate 1 |
27833
|
| G1 2-2 |
replicate 2 |
27833
|
| G1 2-3 |
replicate 3 |
27833
|
Negative control is DNA from a person that does not carry the SNP disease.
Positive control is DNA from a person that does carry the SNP disease
DNA Sample Set-up Procedure
- Step 1 Gather all materials
- Step 2 Cut the strip of PCR tubes so there are 2 strips of four tubes
- Step 3 Label the empty tubes
- Step 4 Place tubes in rack
- Step 5 Take the tube labeled positive control and pipette 50 μL of PCR reaction mix in the tube
- Step 6 Using a new pipette transfer the positive control DNA into the same tube. Mix.
- Step 7 Repeat steps 5 & 6 for negative control patient 1 (1-1, 1-2, 1-3) and patient 2 (2-1, 2-2, 2-3)
- Step 8 All tubes should contain a 100 μL mixture of DNA/primer mix and PCR mix
- Step 9 Close lids on all PCR tubes tightly
- Step 10 Place the tubes into the slots in the PCR machine in the heating block (Don't run machine until all the slots are filled)
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
PCR stands for Polymerase chain reaction and is a technique for isolating and amplifying a target region of DNA. This is done by first heating template DNA to denature it out of its helix form and into strands. (talk about aneeling + complementary base pairs + walk through steps) primers are used to isolate a target region then an enzyme called RNA polymerase as well as building block nucleotides to replicate the section. The solution of genetic material is heated and cooled repeatedly with an amplifying effect due to each replication being double the number of strands produced as the last.
Background: About the Disease SNP
The disease SNP is a pathogenic disease where the codon AGT is replaced with CGT. The chromosome where the variation is located is on 7:117587799. The condition associated with the SNP mutation is cystic fibrosis and heart failure. This mutation is specific in Homo Sapiens and eventually causes death from the heart failure and cystic fibrosis. The numerical position where the SNP is located is 117587799 and the non-disease forward primer is AGAAGGTGGAATCACACTGA. The reverse non-disease primer is CATTATTTATAGTTCTTAAA. The disease forward primer is AGAAGGTGGAATCACACTGC with the disease reverse primer of CATTATTTATAGTTCTTAAA.
Primer Design and Testing
The results of the primer testing came out as a match for the non-disease primer, as seen in the top image below. This is because the primer is set to match the human genome and the DNA sequencing is correct. As seen in the bottom image below, there is no match. This is because we are searching for a disease primer in the human genome but the proper genome sequencing does not include the mutations for the disease we are searching for. Thus there is no match found.
|