Item 3: 8 tubes, 50 microliters each, Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
Item 4: DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA.
Item 5: A strip of empty PCR tubes
Item 6: Disposable pipette tips
Item 7: Cup for discarded tips
Item 8: Micropipettor
Item 9: OpenPCR machine
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G10 +
Positive control
none
G10 -
Negative control
none
G10 1-1
Patient 1, replicate 1
96704
G10 1-2
Patient 1, replicate 2
96704
G10 1-3
Patient 1, replicate 3
96704
G10 2-1
Patient 2, replicate 1
36904
G10 2-2
Patient 2, replicate 2
36904
G10 2-3
Patient 2, replicate 3
36904
DNA Sample Set-up Procedure
Step 1: Obtain materials and patient samples (8 tubes), as well as a positive and negative control and the ID of each patient.
Step 2: Record the ID of the patient for each sample taken.
Step 3: In the 8 tubes, add the polymerase and primers.
Step 4: Samples are ready for PCR.
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q1. What is the function of each component of a PCR reaction?
Template DNA: The double stranded DNA is separated in the first part of the experiment and then the target section of each strand (the template strand) is replicated.
Primers: Primers attach (anneal) to complementary matches on the target DNA sequence. They bracket the target section of the DNA to be copied. DNA polymerase can't attach at just any place and start copying; the primers are what the polymerase attaches to so it can replicate the DNA.
Taq Polymerase: It binds to the primer sequences and adds nucleuotides to the second strand. It copies a cell's DNA before it divides in two.
Deoxyribonucleotides(dNTP’s): They polymerize to form DNA, they are essential building blocks for new DNA strands.
Q2. What happens to the components (listed above) during each step of thermal cycling?
INITIAL STEP: 95°C for 3 minutes: It causes the DNA to unwind into two strands.
Denature at 95°C for 30 seconds: DNA becomes denatures due to the DNA completely unwinding and creates two single stranded DNA molecules.
Anneal at 57°C for 30 seconds: After the DNA has cooled, the DNA will automatically want to recombine however, the primers will have already attached to the target DNA, creating a double helix, which leaves the other strand to remain single stranded. Then, DNA will separate again.
Extend at 72°C for 30 seconds: The polymerase will create the appropriate base pairs for the DNA by attaching itself to the target DNA and will yield a complete copy of the double helix of the original strand.
FINAL STEP: 72°C for 3 minutes: This steps make sure that the single strand is fully extended.
FINAL HOLD: 4°C: This step limits the activity of Taq or other polymerase to prevent nonspecific binding of primers and amplification. Also acts a storage for the reaction for a short period of time.
Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G.
Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to
each base listed below?
Adenine (A): T
Thymine (T): A
Cytosine (C): G
Guanine (G):C
Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answers.
Base pairing will occur between the Annealing and Extension steps. During annealing, short DNA primers are binded with the target DNA after the system is cooled. While the temperature is high, the extension step will occur. During this step, two taq polymerase match up with base primers and extend them to form new nucleotide strands of the target sequences. Once extension is done, then the thermal cycling of base pairing has been completed.
SNP Information & Primer Design
Background: About the Disease SNP
Part 1: Use the NCBI database to find a disease-associated sequence
What is a nucleotide?
A compound consisting of a nucleoside linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acids such as DNA. The nitrogenous bases of nucleotides in DNA are thymine, cytosine, adenine, and guanine.
What is a polymorphism?
Any difference in the nucleotide sequence between individuals. They include: single-base nucleotide substitutions (SNPs), small scale multibase deletions or insertions (DIPs), and retro posable element insertions and microsatellite repeat variations (STRs)
Search for “rs121908757” in the dbSNP database
What species is this variation found in?
Homo Sapien
What chromosome is the variation located on?
7:117587799
What is listed as the Clinical significance of this SNP?
Pathogenic
Click the PubMed link to view summaries of research associated with the SNP. What condition is linked to this SNP?
Cystic fibrosis
Part 2: Find the DNA sequence of the SNP, and the surrounding sequence
What does CFTR stand for?
Cystic Fibrosis Transmembrane Conductance Regulator
What is the function of CFTR? To find out, click the CFTR link. Under Table of Contents (right side) click Gene ontology. Write the first three unique terms you see.
ATP binding, ATPase activity, ATPase coupled anion transmembrane transporter activity
What is an allele?
One of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome.
The disease-associated allele contains what codon?
It goes from AGT → CGT
The numerical position of the SNP is:
117587799
Primer Design and Testing
Part 3: Now that you have a good view of the DNA sequence, you can design primer pairs for PCR.
Non-disease forward primer (20nt):
5’- AGAAGGTGGAATCACACTGA - 3’
The numerical position exactly 200 bases to the right of the disease SNP is: 117587999
Non-disease reverse primer (20nt):
5’ - CATTATTTATAGTTCTTAAA - 3’
Disease forward primer (20nt):
5’ - AGAAGGTGGAATCACACTGT - 3’
Disease reverse primer (20nt):
5’ - ACAGTGTGATTCCACCTTCT - 3’
BME 100 Spring 2017
.jpg)
