BME100 s2014:W Group7 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Error creating thumbnail: File missing
Name: Haley Sivertson
Error creating thumbnail: File missing
Name: Velia Butruz
Error creating thumbnail: File missing
Name: Matthew Welz
Error creating thumbnail: File missing
Name: Valerie McDonald
Error creating thumbnail: File missing
Name: Elizabeth Hansen


DSI Industries is proud to introduce a new generation of DNA analysis. The new and improved PCR machine, SuperNOVA PCR 2000.


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

The TinkerCAD tool is a virtual computer-based software that allows for the design and construction of a limitless range of 3 dimensional models. This tool was used to design a 3D model of the SuperNOVA PCR 2000. It allowed for a complete view of the entire product, inside and outside of the machine.

Our Design


The design is the same size as an average PCR machine. However, there are new additions to the SuperNOVA 2000 that allow for a more efficient testing experience. The heater in the machine is 10% larger than a normal PCR machine. The increase in size allows for heat to be produced at a higher rate so the DNA will denature more quickly. An additional fan was also added to the original design to allow for the DNA to cool more rapidly. The fans are 55% smaller to account for the improved size of the heater. With both heating and cooling happening at a faster rate, the process of analyzing the DNA will be faster rather than the 120 minutes that an average PCR machine.

Feature 1: Disease SNP-Specific Primers

Background on the cancer-associated mutation

The rs237025 is a variation of DNA located on chromosome 6 in humans in which it replaces an allele can be a link to a number of disease, particularly diabetes. The non-disease allele contains GTG whereas in the diseased allele, it is ATG. This variation is located in gene SUM04 or known as small ubiquitin-like modifier 4. It is responsible for encoding ubiquitin-related modifiers. These modifiers attach to proteins and control the protein's activity, stability and localization.


Primer design

  • Disease SNP-specific Forward Primer: 5’ AACCACGGGGATTGTCAATG 3’
  • Reverse Primer: 5’ AGTTTTCTAATTGAGAATGC 3’

How the primers work:

The forward primer is disease-sequence specific. There are twenty bases in it, the first nucleotide is from the allele that is associated with the disease. Since the primer ends with the nucleotide A, which is the disease nucleotide, rather than the non-diseased one, G, only DNA sequences with the disease will replicate. The reverse primer is not disease-sequence specific. The DNA won’t replicate because it is reading the disease alleles. With it being a non-disease allele, it wouldn’t bind 100% so PCR wouldn’t occur and it wouldn’t bind with the complementary strand.

Feature 2: Consumables Kit

The SuperNOVA 2000 S PCR Machine will come with a preassembled consumables kit that contains labeled tubes, PCR mix solutions, primers and micropipettor tips. All products are plastic to ensure cost effectiveness. To make every step easier for the user, our consumables kit is color coordinated for each item. Similarly, the tips will be separated (on opposite sides) of the solutions and primers to eliminate any confusion. The superNOVA PCR also comes with a short and simple step-by-step tutorial displayed on our new display screen and can be looked at whenever necessary.

Feature 3: Hardware - PCR Machine & Fluorimeter

The hard drive that we decided to change was the PCR system. As a team, we felt that the PCR process took a long time. And time, as they say, is money. We decided that we could improve on this weakness without compromising the size of the machine. The idea we had was to increase the size of the heater by 10% of its original size. The idea behind this was to add size to the heater so it would heat up faster speeding up the time of the denaturing process. We would also add two fans to cover the heater, increasing the amount of fans would help with the annealing process. With the two fans instead of one, doubling the max flow of air should cool down the heater and thus speed up the reaction. Since PCR is dealing with a lot of Denaturing and Annealing, with our new addition this should cut down time and allow for faster results and to start new PCR reactions faster.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

The calculations seem to infer that the PCR is not reliable for predicting positives, as the result of calculation three is much less than one. It is however, slightly more effective in predicting negatives, as the result of calculation four was relatively close to one. The results, in unification with one another, would mean that the PCR is not a dependable system of calculating positive results, or negative results.