BME100 s2014:W Group12 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Error creating thumbnail: File missing
Name: Jacqueline Stokes
Error creating thumbnail: File missing
Name: RJ Parkinson
Error creating thumbnail: File missing
Name: Austin Doyle
Error creating thumbnail: File missing
Name: Anthony Zlaket
Error creating thumbnail: File missing
Name: Sara Jerez

LAB 6 WRITE-UP

TinkerCAD

Using Tinkercad, openpcr.org, and Thingiverse, we uploaded pieces of the Open PCR machine onto tinkercad and began the building process. Piece by piece, we sized, rotated, and fitted the different parts of the machine onto an open plane. By the end of the process, our new design for the machine was created.


Our Design

Our Open PCR machine is very similar to the regular design, but with one small modification. For our group, we had difficulty opening the top piece where the DNA is supposed to stay during the PCR reaction, with the rotating handle. So for the sake of ease and less confusion with buyers, we changed the top to instead be a push/pull handle. No more confusing twisting involved.




Feature 1: Disease SNP-Specific Primers

Background on the cancer-associated mutation

rs237025 is a variation, or a polymorphism, in a DNA strand. It is found in homo-sapiens and the clinical significance is listed as "other." The specific chromosome this variation is located on is 6:149721690. Some example diseases associated with this are diabetes, rheumatoid arthritis, and psoriasis vulgaris. This SNP is associated with the gene sum04TAB2, which stands for Small Ubiquitin-like modifier 4. The molecular function of this gene is to attach to proteins to control localization, stability, or activity.


Primer design

  • Disease SNP-specific Forward Primer: 5' TGATTATGATGCTTTCGATG
  • Reverse Primer: 5' AGTTTTCTAATTGAGAATGC

How the primers work: Based on the way the disease-specific primer is designed, the forward primer will bind 100% to a complementary disease-SNP-containing template from a patient sample. The reverse primer will bind 100% to its complementary template. If either primer cannot bind 100% to a template, PCR cannot occur. There would be a different PCR result if the template contains the non-disease allele, seen as CACATCACTGTCATAGAGCT.

Feature 2: Consumables Kit

The consumables will include the same basic materials, but with the addition of an extra micro pipette and less tips. Our idea was to use the two micro pipettes at the same time for the SYBR green and DNA, so that you do not use as many tips and the process is much quicker to complete. All materials will be safely sealed and organized inside of a cardboard box that you will receive when you order the PCR machine. To keep confusion away, instructions for each piece will also be provided.

Feature 3: Hardware - PCR Machine & Fluorimeter

The PCR machine will be separated out, piece by piece, inside of a box that contains instructions for how to set it up completely. In an additional box will be the fluorimeter set-up. The fluorimeter will include a phone stand, the black box, and an adjustable stand.

The stand is where you place your slides and such on top with the blue light. The bottom of the stand will have a turnable knob to adjust for the perfect height of the phone's camera. This way, there will be so unnecessary objects to add underneath the stand to make it taller for the phone, as many groups had to do for this lab.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]