This device is meant for copying certain parts of DNA by using an enzyme driven reaction called PCR. It has a heated lid that heats the DNA from the top. There is also a PCR block which heats DNA from the bottom. Without these two things PCR would not be able to take place. In order for PCR machine to preform its purpose it needs to heat the DNA up to 95 degrees Celsius.
Experimenting With the Connections
When we unplugged (part 3) from (part 6), the machine's display does not work. By disconnecting the wire there was no longer a power supply or data going to the screen.
When we unplugged the white wire that connects (part 6) to (part 2), there was no regulation or sense of temperature. Therefore, the machine kept heating up without stopping at the specific temperature.
Test Run
3/19/14 The OpenPCR machine that we tested passed. It got to 24 cycles in roughly an hour. It heats and cools properly and the program worked.
Protocols
Thermal Cycler Program
Intial Step: 95°C for 3 minutes: Heating up the machine to 95°C in order for the reaction to take place.
Denature at 95°C for 30 seconds: The DNA double helix separtaes making two single tranded DNA molecules.
Anneal at 57°C for 30 seconds: The DNA molecules attempt to pair up, but the primers attach to the DNA before the DNA can rejoin.
Extend at 72°C for 30 seconds: DNA polymerase locates a primer and adds nucleotides onto the strand, this continue until the end of the strand.
Final Step: 72°C for 3 minutes: Replicating the target DNA exponentially.
Final Hold 4°C: Cools the machine down and cools the DNA for storage.
DNA Sample Set-up
Positive control: disease DNA Tube label: PC
Patient 1, Replicate 1: ID# 28375 Tube label: 281
Patient 1, Replicate 2: ID# 28375 Tube label: 282
Patient 1, Replicate 3: ID# 28375 Tube label: 283
Negative control: non-disease DNA Tube label: NC
Patient 2, Replicate 1: ID# 23170 Tube label: 231
Patient 2, Replicate 2: ID# 23170 Tube label: 232
Patient 2, Replicate 3: ID# 23170 Tube label: 233
DNA Sample Set-up Procedure
Step 1: Cut the strip of empty PCR tubes in half to make two strips of four tubes.
Step 2:Label empty microtubes with tube labels group created.
Step 3: Starting with the empty tube labeled positive control transfer 50 μL of PCR reaction mix. Discard the disposable tip into proper waste container. Do not re-use tips and cross-contaminate your samples.
Step 4: Transfer the "+" DNA/primer mix into the same tube. The total volume in the positive control should be 100 μL.
Step 5: Reapeat steps 2 and 3 for the negative control, patient 1 replicates 1, 2, and 3, and patient 2 relicates 1, 2, and 3. Use the appropriate DNA/primer mix for the corresponding tubes. All of the microtubes should have a total volume of 100 μL.
Step 6: Close the lids of the microtubes tightly.
Step 7: Take the tubes and place into the PCR machine.
PCR Reaction Mix
What is in the PCR reaction mix?
Taq Polymerase: The enzyme that assembles nucleotides into new strands of DNA.
Deoxyribonucleotides (dNTP's): They attach to the template DNA that's being copied.
DNA/ primer mix
What is in the DNA/ primer mix?
Template DNA: The DNA that's being copied.
Primers: It matches the segment of DNA that needs to be copied.
Research and Development
PCR - The Underlying Technology
Part 1: Disease-associated sequence
A nucleotide is a five-carbon sugar with one phosphate group. Nucleotides make up the basic units of DNA and RNA molecules. A polymorphism is a DNA sequence variation that is common in the population. rs237025 is a variation found in homosapiens. The chromosome variance is located on 6:149721690 and the clinical significance of this SNP is other. This SNP is associated with SUMO4 and TAB2. We then clicked on PubMed and read the summaries about the Type I Diabetes Genetics Consortium is a family-based candidate gene study. This has established resources to re-evaluate earlier reported genes associated with T1D, using its collection of 2298 Caucasian affected sib-pair families.
Part 2: DNA sequences of SNP
SUMO4 stands for small ubiquitin-related modifier 4. The molecular function of this gene is to encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability. The protein described in this record is located in the cytoplasm and specifically modifies IKBA. The non-disease allele contains GTG.A. Change in this allele at the G position is linked to the disease. The allele is ATG. The diseased associated with the allele is type 1 diabetes. The numerical position of the SNP is 149721690.
Part 3: Design diseased sequenced DNA
The forward primer sequence for the diseased associated allele is 5' TACTTCGTCTAGTCTAAGGC and the numerical position 200 bases to the right is 149721890. For the reverse primer sequence is 5' AGTTTTCTAATTGAGAATCG. If you're going to attach a diseased primer to a non-diseased template the PCR would not happen correctly. This is because the forward primer will not attach at all because of the mismatch bases. What would happen is the Taq polymerases will continue to replicate all the way though without the forward primer.
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the PCR video/ tutorial might be useful. Be sure to credit the sources if you borrow images.)
BME 100 Spring 2014
