BME100 s2014:T Group6 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Error creating thumbnail: File missing

Error creating thumbnail: File missing
Name: Nicole D. Fisk
Error creating thumbnail: File missing
Name: Doan-Nhi T. Tran
Error creating thumbnail: File missing
Name: Mark A. Keppler
Error creating thumbnail: File missing
Name: Rayan S. Altayyar
Error creating thumbnail: File missing
Name: Brittani M. Ogden


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a free online program used to create computer-aided design. It's simple to use interface allows beginners and students to experiment with modeling 3D objects. This tool makes a digital template that can be printed into physical objects with the aid of a 3D printer. In November, our lab group used the TinkerCAD tool to fabricate a design for a vascular graft that continuously monitors vitals. TinkerCAD allowed us to visualize our original product and identify potential problems.


Our Design

Our redesign of the OpenPCR machine aims to improve the efficiency of the heating/cooling process required by a Polymerace Chain Reaction. The improvement simply embellishes the original design by adding long slits on the sides of the box. These long slits are meant to to increase ventilation as the machine heats up to high temperatures and cooled down rapidly. These additions do not directly affect the inner workings of the process, they simply allow the machine to run smoother by preventing the device from heating up. Additionally, the slits allow the the person running the machine to easily peek inside and spot malfunctions without taking the box apart completely.



Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation

Small ubiquitin-like modifier 4 (SUMO4; rs237025) is a gene located on chromosome 6 that aids in the regulation of NF-kappa-B transcription factor. NF-kappa-B has been linked to immunoglobulin formation, and disruption of its formation due to translational errors on SUMO4 can lead to various autoimmune and inflammatory syndromes. The gene is most commonly correlated to the incidence of Type I Insulin Dependent Diabetes Mellitus. When the GTG codon located at gene position 149721690 on chromosome 6 undergoes a point mutation, an ATG codon at that location is formed that causes the gene to code for Valine instead of Methionine. Disease specific primers can be produced that can recognize this mutation and bind to it. This process is useful in PCR analysis because it allows geneticists the opportunity to amplify genetic material that is positive for a mutation of interest. The forward primer is created by using the portion of the gene found at 149721690 to create a 20 nucleotide forward primer sequence that will be able to bind directly to the disease specific complement strand on the patient DNA. The reverse primer does not need to be disease specific, but is necessary in order to facilitate the DNA amplification process during PCR analysis.

Primer design

  • Disease SNP-specific Forward Primer: 5’AACCACGGGGATTGTCAATG3’
  • Reverse Primer: 5'AGTTTTCTAATTGAGAATGC3'

How the primers work: If the patient is negative for this disease, their DNA sample used for PCR analysis will not be amplified due to an inability of the primer to bind to the patient sample. If there is a high concentration of DNA within the PCR sample after amplification the patient is said to be positive for the genetic sequence.



Feature 2: Consumables Kit

Included in our complete consumables kit:

  • buffer tubes
  • micropipette
  • micropipette tips
  • glass slides
  • PCR tubes
  • tube rack
  • calf thymus


SYBR Green I is a light sensitive dye that binds to DNA. In our experiment, foil was placed on top of the tube(s) containing SYBR Green I. The foil failed to cover the entirety of the tube. In our new designed kit, the color of the tubes containing SYBR Green I are colored black in order to avoid any light hitting the dye. The rack containing all the test tubes will come a bit bigger in order to hold more of the tubes. All items listed will come in one complete kit instead of having to buy or grab all parts separately. It will contain the right amount of slides, tubes, and tips needed.


Feature 3: Hardware - PCR Machine & Fluorimeter

IsentroTech aims to address the most common complaint about amplifying and analyzing a DNA sample: the process duration. In order to shorten the time of the overall process, our team has decided to alter the design of both the PCR machine and the Fluorimeter. The current PCR machine design can hold 16 tubes of sample DNA. Our improved design will double the capacity, allowing the PCR machine to run 32 samples at a time. This enhancement will yield an equivalent amount of DNA in half the time. Our new system will also speed up the process of sample analysis by revising the design of the fluorimeter. Instead of capturing an image of one sample at a time, our improved device will be able to take one image of multiple samples at once. We will accomplish this by lining the droplets side by side and shining multiple lights beams at once through each sample on a vertical axis. The original system requires the user to carry out the monotonous process of adding a single sample to the slide, adjusting the camera, covering the device with a light box, taking the picture, and removing the box. One repetition of this 5-step process yields only one result. Our elongated slide allows the camera to capture up to 5 samples in one repetition.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

Calculations 3 and 4 measured the positive predictive value and the negative predictive value of the PCR process, respectively. The positive predictive value (PPV), or the probability that the person that receives a positive result actually has the disease, is theoretically supposed to be 100%. However, for calculation 3, the calculated value for the PCR results was more than 30% away from 100%. This means that the machine is not an effective predictor, and therefore there is a rather high probability that a patient given a positive result does not actually have the disease. For calculation 4, the negative predictive value (NPV) was found. This value is the probability that someone who receives a negative test result does not have the disease. This calculated value for the PCR test for the SUMO4 gene and its existence in the patient was somewhat closer to 100% than calculation 3. For calculation 4, the value was slightly over 10% below the 100% golden standard. This means that it has a relatively high NPV, meaning it does not offer as many false negatives as it does false positives, and one can be fairly confident that their negative result is accurate. One factor to consider is the prevalence of the disease in the general population. Because a group of people from the general population were tested, and not those just at risk for the disease, the NPV and PPV values could have been slightly affected. Obviously the prevalence of the disease is lower in the general population than in a group of at risk people. This could have caused the PPV value to be lower than if just at-risk people were tested because more people without the disease in the group means a greater chance of a false positive. A similar, but opposite, phenomenon would occur with the NPV value. Because there are fewer people that would test negative in an at-risk population, there is a larger chance of a false negative. This is simply due to the fact that there are fewer people that would actually be negative for the disease, whereas in the general population the number of people truly negative for the disease is much larger. Due to this, one must consider if he or she is part of the at-risk population or the general population when deciding the probability that his or her test results are correct.