BME100 s2014:T Group4 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2014 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR COMPANY

Error creating thumbnail: File missing
Name: Parker Davis
Error creating thumbnail: File missing
Name: Daniel Munoz
Error creating thumbnail: File missing
Name: Brian Kalen
Error creating thumbnail: File missing
Name: Michael Spina
Error creating thumbnail: File missing
Name: Rakan Aldrssary



Company: Oxford Medical
Device: PCR 3000


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD


TinkerCAD was an easier Solid Works. TinkerCad helpped us create our 3D and realistic image of our product. By rotating the image and adding shapes and colors you can make any 3 dimensional object. TinkerCAD has a variety of tools and devices that can be used to alter the project being made. You can put holes through the objects to make them into something like a braclet, and do things like cutting the object as well. 3D models of the PCR machine were downloaded, and then the shell of the PCR was assembled. TinkerCAD uses either hand made objects or downloaded objects in order to create projects.

Our Design


Our new design was created with the idea that the PCR machine needed to be able to hold more tubes. Therfore, to the testing bay we added additional rows and columns to the machine. Then the machine was assembled exactly the same as the normal PCR machine. The main flaw with the normal PCR machine we found it that it can only hold about 16 tubes. Adding more sockets for tubes allows for testing in a more mass amount. This can lead to drawing conclusion faster, because we will be able to test more tubes at once. This new machine will speed up the process of testing because more tubes can be tested at one time.


Feature 1: Disease SNP-Specific Primers

Background on the disease-associated mutation


RS237025 is found in Homo sapiens. On chromosome 6:149721690. RS237025 effects the genes SUMO4 and TAB2. This SNP increases the risk of type I diabetes. The SUMO4 that is effected by rs237025 stands for small ubiquitin - like modifier 4. This SUMO4 is found in the cytoplasm and modifies IKBA which can cause type I diabetes.


Primer design

  • Disease SNP-specific Forward Primer: 5`--> AACCACGGGGATTGTCAATG <--3’
  • Reverse Primer: 5’--> AGTTTTCTAATTGAGAATGC <--3’

How the primers work:

A primer is a 3 base sequence that provides the starting point for DNA synthesis. The primer sequence is the specific base pair of the diseased gene in the sample DNA strand, meaning the SNP-specific primer will only bind to that disease causing SNP. With this primer present, the DNA strand containing the diseased gene will be replicated, growing exponentially. If this primer is used with a non diseased DNA strand, no replication would occur because there would be no place for the primer to bind on the non diseased DNA strand.



Feature 2: Consumables Kit

The tray that held the tubes in the PCR machine could not hold very many tubes. To address this problem we enlarged the tube tray to be able to hold a much greater amount of tubes. This can greatly increase the rate of tubes that can be tested at once. The tubes themselves we kept the same size and shape. However the PCR machine had unused space on both sides of the tube holding tray. Therefore, on TinkerCAD we extended the tube holding tray inorder to add more slots for additional tubes.

The major weakness this redesign addresses it how long it takes the PCR machine to test only a small amount of tubes. We looked at the PCR machine in two ways. The first way was reducing the time per cycle. This seemed largely difficult and could diminish the accuracy of the test. The second way was to add more tubes so that the time er cycle would stay the same, but since more tubes were present the amount of tubes tested in a certain time would go up. We decided increasing the number of tubes per test would increase the rate at which tubes are tested. tampering with the cycle time was too risky, and merely adding more tubes was a simple and effective alternative.


Feature 3: Hardware - PCR Machine & Fluorimeter

The PCR and fluorimeter will be separate devices. The fluorimeter will remain unchanged. The PCR was only minimally altered in the consumables area. This was to allow more tubes to be tested. The PCR machine has a specific job, and to try to make it do too many things could sacrifice accuracy. In our case we want the accuracy to be maximized so therefore, only minimal and reasonable changes were made to the PCR machine.

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

The calculations show that the PCR is not reliable for predicting the disease, as the result of calculation three and four are significantly less than one. However, PCR's reliability of detecting the disease is very high, shown by the results of calculations one and two being close to 1. With these results, we can conclude that PCR reactions are dependable for detecting the diseased SNP, but are not dependable for predicting the actual occurrence of the disease.