|
PCR Au
Company Name: PCR Au
LAB 6 WRITE-UP
Computer-Aided Design
TinkerCAD
The TinkerCAD tool is used to build models. We specifically used the TinkerCAD tool to model the PCR machine. We recreated the parts which make up the current machine design, but then added our changes. The changes were made in order to fix the PCR machine weaknesses.
Our Design
PCR Machine Exterior
PCR Machine Well Plate
The design for our PCR machine maintains the strengths of the original machine we used while fixing the weaknesses. One of the key weaknesses of the original PCR machine was its slow speed which we chose to correct. We altered the design by inserting a gold heat equalizing layer in the well plate. This layer was placed in this location because it is between the heating and cooling plates of the thermal system. Gold was used because it has a high level of thermal conductivity.
Feature 1: Disease SNP-Specific Primers
Background on the disease-associated mutation
A nucleotide is a monomer of a nucleic acid while a polymorphism is when two different phenotypes occur in the same species population. The variation rs237025 is found in the Homo sapien species located on the chromosome 149721690 in position 25. The clinical significance of this variation is categorized as other. This SNP is associated with the SUM04 (small-ubiquitin-related modifier 4) and TAB2 genes. The SUM04 gene attaches to target lysenes and controls the target protein's activity and stability. This SNP is also associated with diseases, particularly diabetes. The non-disease allele (alternative form of gene) is GTG while the disease allele is ATG.
Primer design
- Disease SNP-specific Forward Primer: 5'- AACCACGGGGATTGTCAATG
- Reverse Primer: 5'- TGCAATTTGGTTCCACCACA
How the primers work:
The primers are disease-sequence specific because they are composed of a specific combination of alleles. The primers will amplify DNA that contains the disease-associated SNP because the primers are designed to match perfectly at a specific SNP location. The primers will not exponentially amplify DNA that has the non-disease allele because it is not designed to match up to that allele. The base pairs will not line up and match.
Feature 2: Consumables Kit
Our consumables will be packaged in a compact user friendly kit. The items will be clearly labeled and easy to identify.
Consumables (Reagents and Plastic ware)
1. Sharpie
2. Tube Rack
3. Buffer Tubes
4. SYBR Green 1 Solution Tubes
5. H20 Tubes
6. Calf Thymus DNA Tubes
7. PCR Reaction Sample Tubes
Our new consumable kit addresses the major weakness of the original consumable kit: the light sensitivity of the SYBR Green 1 solution. This weakness will be dealt with by making the SYBR Green 1 solution tubes light resistant in order to avoid the hassle and messiness of struggling to cover the SYBR Green 1 solution tubes. This alteration will make the consumables kit more user friendly, less prone to error, and more efficient.
Feature 3: Hardware - PCR Machine & Fluorimeter
The PCR machine will be included in the system to amplify a segment of DNA at a faster rate. It will do so by certain deviance from the normal make-up of PCR machines. The fluorimeter will be included in the system to analyze transmittance of light through a DNA-containing droplet through virtual image analysis software. To improve consistency of the fluorimeter, new devices will be added that were not previously part of the PCR-Fluorimeter system that will connect the two in the most efficient means feasible.
The biggest problem with the PCR machine was the speed that thermal cycler cools the DNA and reaction mix. To improve this, layer of more thermally conductive metal, gold, was placed in between the heating and cooling units of the well plate holding the test tubes in place. The increase in the thermal conductivity of the well plate metal will make the dramatic changes from hot to cold during the PCR reaction more efficient and timely.
The issue with the fluorimeter was the inconsistency in the pictures that it took to be analyzed for color transmittance. In order to fix this problem, a stand, which may be positioned, for a smartphone/camera will be added to ensure that the lens is at the same distance fro the droplet for all pictures. This stand will be on a movable track, which will allow the user to position the camera in the proper place for the most focused and close up picture possible. It will be possible to lock the track in place once the best position is set. This will ensure that all preceding pictures are at the same position, as well.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach
Calculations 3 and 4 imply that the reliability of PCR for predicting the disease is fairly low, particularly for predicting positive results. Calculation 3 which determined the probability that a patient will develop the disease given a positive final test conclusion produced a relatively small value. Calculation 4 which determined the probability that a patient will not develop the disease given a negative final test conclusion produced a value that was notably closer to one than calculation 3, but still was not ideal. Thus the conclusion can be made that the PCR is somewhat accurate in predicting negative disease results, but not very likely in predicting positive disease results. This means that false positives are fairly likely to occur, but a negative test conclusion means an individual most likely does not have the disease.
|