BME100 f2017:Group8 W0800 L4

BME 100 Fall 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Janet Vargas Name: Cassie Riggs Name: Megan Pitts Name: Chandler Ryder Name: Jinpyo Seo LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless -master-mix-m714-protocol/) DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes*Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G8 + Positive control none G8 - Negative control none G8 1-1 Patient 1, replicate 1 21428 G8 1-2 Patient 1, replicate 2 21428 G8 1-3 Patient 1, replicate 3 21428 G8 2-1 Patient 2, replicate 1 85431 G8 2-2 Patient 2, replicate 2 85431 G8 2-3 Patient 2, replicate 3 85431 DNA Sample Set-up Procedure Before the PCR experiment, gather sample extracted DNA from both patients. For the first patient, place his/her extracted DNA with a pipette into a PCR tube. Then add primer 1 and primer 2 for the initiation of the chain reaction into the same PCR tube. Finally, add nucleotide bases for the DNA replication and the DNA polymerase to build the DNAs into the PCR tube. Place the tube with all the required materials into the thermal cycler. The cycler will go through a process of heating and cooling for ideal states of replication, so allow the reactions to take place. After many cycles, the tube should consist of mainly the sample DNA. Extract the solution of the newly acquired sample DNA. Repeat the process with the extracted DNA for the second patient. OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes (The DNA will start to unwind) NUMBER OF CYCLES: 25 DENATURE at 95°C for 30 seconds, Anneal at 57°C for 30 seconds (Now the DNA will be into two strands) EXTEND at 72°C for 30 seconds (Now the DNA polymerase will bond to the DNA and start pairing nucleotides) FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology PCR is a technology that scientists can use to replicate a desired template strand numerous times inexpensively. For this experiment, a sample of DNA will be required and will be included in a test tube along with the primers of the specific gene that is searched for, nucleotide for base pairing, and DNA polymerase for the process of replication. The test tube will be inserted into the thermocyclers and the cycles will begin. A target sequence will be sought after, then the temperature will be increased to 95 degrees Celsius to separate the double helix. It will then be cooled to 50 degrees Celsius for the primers to attach. Finally, temperature will rise to 72 degrees Celsius for polymerases to add the nucleotides. This cycle will repeat for multiple replications, which will result in many samples of the desired DNA. Q1. What is the function of each component of a PCR reaction? During the PCR process, template DNA will function as a base for the replication process to occur. Once the template DNA is set then the primers will attach to specific sites on the template DNA, these primers will give the binding location for DNA polymerase. The DNA polymerase will bind to the primer and then will utilize the nucleotides present to complete the other portion of DNA after the DNA was split. Question 2 What happens to the components (listed above) during each step of thermal cycling? INITIAL STEP: 95°C for 2 minutes:Heating the samples to 95 degrees Celsius makes the DNA's double helix begin to unwind. Denature at 95°C for 30 seconds:The DNA now is becoming twice as many single-strands than the initial sample amount. This is known as denaturing. Anneal at 57°C for 30 seconds:Now that the sample is cooled to 57 degrees Celsius, the primers have already attached to their target sequence, and made the single strand a double-helix. This leaves the original DNA to remain as single-strands, and the DNA samples separate again, leaving the sample with twice as many target DNA strands. Extend at 72°C for 30 seconds:At 72 degrees Celsius, the polymerase will attach itself to the target DNA and begin pairing bases until it reaches the primers on the end of the strands. FINAL STEP: 72°C for 2 minutes:This is to make sure the single-stranded DNA is completely extended, and the completed replications of the initial DNA sample are in the form of a double-helix. FINAL HOLD: 4°C:This temperature of 4-degree Celsius is used to store the sample for a short period of time. Q3. Nucleotide Base-pairing Adenine(A)-Thymine(T) Thymine(T)-Adenine(A) Cytosine(C)-Guanine(G) Guanine(G)-Cytosine(C) Q4. During which two steps of thermal cycling does base-pairing occur? The steps in which the temperature of the solution is increased to 72 degrees Celsius and base-pairing can occur by the DNA polymerase in a process called elongation. At the end of the cycles, final elongation will take place to make use of all nucleotide base-pairs. SNP Information & Primer Design Background: About the Disease SNP SNP are single nucleotide polymorphisms which are a type of genetic variation between people, essentially SNPs are nucleotides. Each person has approximately 3 million SNPs but out of the millions, SNPs only occurs in approximately 1 out of every 300 nucleotides. What makes SNPs special is that they can be used as genetic markers, which help identify genes that are associated with a disease. SNPs can be used to predict a person susceptibility to addiction, etiology of diseases, and determine hereditary diseases within a family. On the other hand, if an SNP occurs in a gene it may actually be a factor for which a disease is developed which in turn begins to affect the gene's functionality. The identification of the diseases can be found through a Genome-Wide Association Study (GWAS) which identifies recurrent SNPs in a persons genetic sequence. Primer Design and Testing What is a nucleotide? A nucleotide is the building block for DNA. It is the smallest piece of DNA. It varies from A, T,C, and G. What is a polymorphism? Polymorphism in DNA is the difference in the sequence of DNA among individuals. What species is this variation found in? Homo Sapiens What chromosome is the variation located on? 19:44907853 What is listed as the Clinical significance of this SNP? Pathogenic What condition is linked to this SNP? Alzheimers What does APOE​ stand for? Apolipoprotein E What is the function of APOE? This gene will provide instructions that will lead to the creation of Apolipoprotein E Write the first three unique terms you see. Amyloid-beta binding, protein binding, phospholipid binding. What is an allele? An allele is a gene located in a specific area along a chromosome. They determine a trait in an individual. The disease-associated​ ​allele contains what codon? CCG The numerical​ ​position​ ​of​ ​the​ ​SNP​ is: 44907853 Non-disease For this part of the lab we designed a non-disease forward primer at the position of 44907853. Then we designed a non-disease reverse primer by adding 200 to the original position to simulate two primers amplifying the DNA. Non-disease forward primer 5’AGCGGCCAGCGCTGGGAACT3’ Non-disease reverse primer position 44908053 5’CAGGCCCCCCAAGACTTAGC3’ Results Non-disease Disease For this part of the lab we designed a disease forward and reverse primer by simply taking the designed non-disease forward and reverse primers and changing the last base on the forward primer to the disease. Disease Forward Primer 5’AGCGGCCAGCGCTGGGAACC3’ Disease Reverse Primer 5’CAGGCCCCCCAAGACTTAGC3’ Results Disease