BME100 f2017:Group6 W0800 L4

From OpenWetWare
Jump to navigationJump to search
Owwnotebook icon.png BME 100 Fall 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png


OUR TEAM

Name: Tim Oetter
Name: Joshua Gunn
Name: Trevor Heaton
Name: Jesus Dorame
Name: Tajinder Uppal

LAB 4 WRITE-UP

Protocol

Materials

  • Lab​ ​coat​ ​and​ ​disposable​ ​gloves
  • PCR​ ​reaction​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Mix​ ​contains​ ​Taq​ ​DNA​ ​polymerase,​ ​MgCl​2​,​ ​and​ ​dNTP’s
  • DNA/​ ​primer​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Each​ ​mix​ ​contains​ ​a​ ​different​ ​template​ ​DNA.​ ​All​ ​tubes have​ ​the​ ​same​ ​forward​ ​primer​ ​and​ ​reverse​ ​primer
  • A​ ​strip​ ​of​ ​empty​ ​PCR​ ​tubes
  • Disposable​ ​pipette​ ​tips:​ ​only​ ​use​ ​each​ ​only​ ​once.​ ​​Never​ ​reuse​ ​disposable​ ​pipette​ ​tips​.​ ​If​ ​you​ ​do, the​ ​samples​ ​will​ ​become​ ​cross-contaminated
  • Cup​ ​for​ ​discarded​ ​tips
  • Micropipettor
  • OpenPCR​ ​machine:​ ​shared​ ​by​ ​two​ ​groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G6 + Positive control none
G6 - Negative control none
G6 1-1 Patient 1, replicate 1 40032
G6 1-2 Patient 1, replicate 2 40032
G6 1-3 Patient 1, replicate 3 40032
G6 2-1 Patient 2, replicate 1 98170
G6 2-2 Patient 2, replicate 2 98170
G6 2-3 Patient 2, replicate 3 98710


DNA Sample Set-up Procedure

  1. Start by moving the extracted DNA into a special PCR tube
  2. Label patients extracted DNA
  3. Next add Primer 1 to the PCR tube
  4. Now add Primer 2
  5. Add nucleotides to your PCR tube
  6. Add the DNA Polymerase to the PCR tube
  7. Place the PCR tube into a DNA thermal cycler

OpenPCR program

  • HEATED LID - 100°C
  • INITIAL STEP - 95°C​ ​for​ ​2​ ​minutes
  • NUMBER OF CYCLES - 25
    • Denature​ ​at​ ​95°C​ ​for​ ​30​ ​seconds
    • Anneal​ ​at​ ​57°C​ ​for​ ​30​ ​seconds
    • Extend​ ​at​ ​72°C​ ​for​ ​30​ ​seconds
  • FINAL STEP - 72°C​ ​for​ ​2​ ​minutes
  • FINAL HOLD - ​4°C





Research and Development

PCR - The Underlying Technology

Q1 - What is the function of each component of a PCR reaction?

  • Template DNA: This is the DNA strand of interest. We want to amplify part of the DNA sequence so it is easier to view.
  • Primers: Attach to the part of the DNA sequence that you want to copy and amplify
  • Taq Polymerase: Reads and replicates the DNA sequence of interest to create more copies. Taq polymerase is used in PCR because of its unique ability to withstand high temperatures.
  • Deoxyribonucleotides (dNTP's): These are the building blocks of DNA that will be used to make copies of the template DNA


Q2.​ ​What​ ​happens​ ​to​ ​the​ ​components​ ​(listed​ ​above)​ ​during​ ​each​ ​step​ ​of​ ​thermal​ ​cycling?

  • INITIAL​ ​STEP:​ ​95°C​ ​for​ ​2 minutes --> Preheats the DNA thermal cycler and establishes the desired temperature
  • Denature​​ ​at​ ​95°C​ ​for​ ​30 seconds: The double stranded DNA sequence falls apart resulting in two single stranded DNA sequences
  • Anneal​​ ​at​ ​57°C​ ​for​ ​30​ ​seconds: Primers bind to their respective target sequences
  • Extend​​ ​at​ ​72°C​ ​for​ ​30​ ​seconds: At this temperature Taq polymerase is activated. Polymerase finds the primers, attaches to the DNA single strands, and begins to add complimentary nucleotides to each sequence to create the new DNA strands.
  • FINAL​ ​STEP:​ ​72°C​ ​for​ ​2 minutes --> Allows Taq polymerase to continue copying
  • FINAL​ ​HOLD:​ ​4°C --> The DNA is cooled to a very low temperature in order to stabilize the many new sequences


Q3. Base-pairing,​ ​driven​ ​by​ ​hydrogen​ ​bonding,​ ​allows​ ​base​ ​pairs​ ​to​ ​stick​ ​together.​ ​Which​ ​base​ ​anneals​ ​to​ ​each base​ ​listed​ ​below?

  • Adenine (A): Binds to Thymine (T)
  • Thymine (T): Binds to Adenine (A)
  • Cytosine (C): Binds to Guanine (G)
  • Guanine (G): Binds to Cytosine (C)


Q4.​ ​During​ ​which​ ​two​ ​steps​ ​of​ ​thermal​ ​cycling​ ​does​ ​base-pairing​ ​occur?​ ​Explain​ ​your​ ​answers.

  1. Annealing: The primers attach to the sequence of DNA that consists of their complimentary base pairs
  2. Extending: Taq Polymerase creates the new DNA strand by adding complimentary nucleotides to the existing strand





SNP Information & Primer Design

Background: About the Disease SNP

What is a nucleotide?

  • The basic structural unit of DNA. It is a compound consisting of a nucleoside linked to a phosphate group.

What is a polymorphism?

  • The presence of genetic variation within a population.

What​ ​species​ ​is​ ​this​ ​variation​ ​found​ ​in?​

  • Homo Sapiens

What​ ​chromosome​ ​is​ ​the​ ​variation​ ​located​ ​on?

  • 19:44907853

What​ ​is​ ​listed​ ​as​ ​the​ ​​Clinical Significance of this SNP?

  • Pathogenic

What​ ​condition​ ​is linked​ ​to​ ​this​ ​SNP?

  • Alzheimer's Disease

What does APOE stand for?

  • Apolipoprotein E

What is the function of APOE?

  • Amyloid-beta binding
  • Antioxidant activity
  • Cholesterol binding

What is an allele?

  • An alternate form of a gene that arises from mutation

The​ ​​disease-associated​ ​allele contains​ ​what​ ​codon?

  • CTG -> CCG


Primer Design and Testing

The​ ​​numerical​ ​position​ ​of​ ​the​ ​SNP​​ ​is:

  • 44907853

Non-disease​ ​forward​ ​primer​ ​(20​ ​nt):

  • AGCGGCCAGCGCTGGGAACT

The​ ​numerical​ ​position​​ ​exactly​ ​200​ ​bases to​ ​the​ ​right​ ​of​ ​the​ ​disease​ ​SNP​​ ​is:

  • 44908053

Non-disease​ ​reverse​ ​primer​ ​(20​ ​nt)​:

  • AGGCCCCCCAAGACTTAGCG

Disease​ ​forward​ ​primer​ ​(20​ ​nt):

  • AGCGGCCAGCGCCGGGAACC

Disease​ ​reverse​ ​primer​ ​(20​ ​nt):

  • AGGCCCCCCAAGACTTAGCG