BME100 f2017:Group6 W0800 L4

BME 100 Fall 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Name: Tim Oetter Error creating thumbnail: Unable to save thumbnail to destination Name: Joshua Gunn Error creating thumbnail: Unable to save thumbnail to destination Name: Trevor Heaton Error creating thumbnail: Unable to save thumbnail to destination Name: Jesus Dorame Error creating thumbnail: Unable to save thumbnail to destination Name: Tajinder Uppal LAB 4 WRITE-UP Protocol Materials Lab​ ​coat​ ​and​ ​disposable​ ​gloves PCR​ ​reaction​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Mix​ ​contains​ ​Taq​ ​DNA​ ​polymerase,​ ​MgCl​2​,​ ​and​ ​dNTP’s DNA/​ ​primer​ ​mix,​ ​8​ ​tubes,​ ​50​ ​μL​ ​each:​ ​Each​ ​mix​ ​contains​ ​a​ ​different​ ​template​ ​DNA.​ ​All​ ​tubes have​ ​the​ ​same​ ​forward​ ​primer​ ​and​ ​reverse​ ​primer A​ ​strip​ ​of​ ​empty​ ​PCR​ ​tubes Disposable​ ​pipette​ ​tips:​ ​only​ ​use​ ​each​ ​only​ ​once.​ ​​Never​ ​reuse​ ​disposable​ ​pipette​ ​tips​.​ ​If​ ​you​ ​do, the​ ​samples​ ​will​ ​become​ ​cross-contaminated Cup​ ​for​ ​discarded​ ​tips Micropipettor OpenPCR​ ​machine:​ ​shared​ ​by​ ​two​ ​groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G6 + Positive control none G6 - Negative control none G6 1-1 Patient 1, replicate 1 40032 G6 1-2 Patient 1, replicate 2 40032 G6 1-3 Patient 1, replicate 3 40032 G6 2-1 Patient 2, replicate 1 98170 G6 2-2 Patient 2, replicate 2 98170 G6 2-3 Patient 2, replicate 3 98710 DNA Sample Set-up Procedure Start by moving the extracted DNA into a special PCR tube Label patients extracted DNA Next add Primer 1 to the PCR tube Now add Primer 2 Add nucleotides to your PCR tube Add the DNA Polymerase to the PCR tube Place the PCR tube into a DNA thermal cycler OpenPCR program HEATED LID - 100°C INITIAL STEP - 95°C​ ​for​ ​2​ ​minutes NUMBER OF CYCLES - 25 Denature​ ​at​ ​95°C​ ​for​ ​30​ ​seconds Anneal​ ​at​ ​57°C​ ​for​ ​30​ ​seconds Extend​ ​at​ ​72°C​ ​for​ ​30​ ​seconds FINAL STEP - 72°C​ ​for​ ​2​ ​minutes FINAL HOLD - ​4°C Research and Development PCR - The Underlying Technology Q1 - What is the function of each component of a PCR reaction? Template DNA: This is the DNA strand of interest. We want to amplify part of the DNA sequence so it is easier to view. Primers: Attach to the part of the DNA sequence that you want to copy and amplify Taq Polymerase: Reads and replicates the DNA sequence of interest to create more copies. Taq polymerase is used in PCR because of its unique ability to withstand high temperatures. Deoxyribonucleotides (dNTP's): These are the building blocks of DNA that will be used to make copies of the template DNA Q2.​ ​What​ ​happens​ ​to​ ​the​ ​components​ ​(listed​ ​above)​ ​during​ ​each​ ​step​ ​of​ ​thermal​ ​cycling? INITIAL​ ​STEP:​ ​95°C​ ​for​ ​2 minutes --> Preheats the DNA thermal cycler and establishes the desired temperature Denature​​ ​at​ ​95°C​ ​for​ ​30 seconds: The double stranded DNA sequence falls apart resulting in two single stranded DNA sequences Anneal​​ ​at​ ​57°C​ ​for​ ​30​ ​seconds: Primers bind to their respective target sequences Extend​​ ​at​ ​72°C​ ​for​ ​30​ ​seconds: At this temperature Taq polymerase is activated. Polymerase finds the primers, attaches to the DNA single strands, and begins to add complimentary nucleotides to each sequence to create the new DNA strands. FINAL​ ​STEP:​ ​72°C​ ​for​ ​2 minutes --> Allows Taq polymerase to continue copying FINAL​ ​HOLD:​ ​4°C --> The DNA is cooled to a very low temperature in order to stabilize the many new sequences Q3. Base-pairing,​ ​driven​ ​by​ ​hydrogen​ ​bonding,​ ​allows​ ​base​ ​pairs​ ​to​ ​stick​ ​together.​ ​Which​ ​base​ ​anneals​ ​to​ ​each base​ ​listed​ ​below? Adenine (A): Binds to Thymine (T) Thymine (T): Binds to Adenine (A) Cytosine (C): Binds to Guanine (G) Guanine (G): Binds to Cytosine (C) Q4.​ ​During​ ​which​ ​two​ ​steps​ ​of​ ​thermal​ ​cycling​ ​does​ ​base-pairing​ ​occur?​ ​Explain​ ​your​ ​answers. Annealing: The primers attach to the sequence of DNA that consists of their complimentary base pairs Extending: Taq Polymerase creates the new DNA strand by adding complimentary nucleotides to the existing strand SNP Information & Primer Design Background: About the Disease SNP What is a nucleotide? The basic structural unit of DNA. It is a compound consisting of a nucleoside linked to a phosphate group. What is a polymorphism? The presence of genetic variation within a population. What​ ​species​ ​is​ ​this​ ​variation​ ​found​ ​in?​ Homo Sapiens What​ ​chromosome​ ​is​ ​the​ ​variation​ ​located​ ​on? 19:44907853 What​ ​is​ ​listed​ ​as​ ​the​ ​​Clinical Significance of this SNP? Pathogenic What​ ​condition​ ​is linked​ ​to​ ​this​ ​SNP? Alzheimer's Disease What does APOE stand for? Apolipoprotein E What is the function of APOE? Amyloid-beta binding Antioxidant activity Cholesterol binding What is an allele? An alternate form of a gene that arises from mutation The​ ​​disease-associated​ ​allele contains​ ​what​ ​codon? CTG -> CCG Primer Design and Testing The​ ​​numerical​ ​position​ ​of​ ​the​ ​SNP​​ ​is: 44907853 Non-disease​ ​forward​ ​primer​ ​(20​ ​nt): AGCGGCCAGCGCTGGGAACT The​ ​numerical​ ​position​​ ​exactly​ ​200​ ​bases to​ ​the​ ​right​ ​of​ ​the​ ​disease​ ​SNP​​ ​is: 44908053 Non-disease​ ​reverse​ ​primer​ ​(20​ ​nt)​: AGGCCCCCCAAGACTTAGCG Disease​ ​forward​ ​primer​ ​(20​ ​nt): AGCGGCCAGCGCCGGGAACC Disease​ ​reverse​ ​primer​ ​(20​ ​nt): AGGCCCCCCAAGACTTAGCG