BME100 f2017:Group5 W0800 L4

From OpenWetWare
Jump to navigationJump to search
BME 100 Fall 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Error creating thumbnail: File missing
Name: Anna
Role(s): Team member
Error creating thumbnail: File missing
Name: Anu Pal
Role(s): Team member
Error creating thumbnail: File missing
Name: Joey Gurule
Role(s): Team member
Error creating thumbnail: File missing
Name: Savina Plougmann
Role(s): Team member
Error creating thumbnail: File missing
Name: Curran McGraw
Role(s): Team member

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2 , and dNTP’s
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
5 + Positive control none
5 - Negative control none
5 1-1 Patient 1, replicate 1 65206
5 1-2 Patient 1, replicate 2 65206
5 1-3 Patient 1, replicate 3 65206
5 2-1 Patient 2, replicate 1 61695
5 2-2 Patient 2, replicate 2 61695
5 2-3 Patient 2, replicate 3 61695


DNA Sample Set-up Procedure

  1. Label 8 tubes with appropriate labels.
  2. Pipette PCR reaction mix into each tube.
  3. Pipette appropriate DNA/primer mix into each tube.
  4. Place the tubes in the thermal cycler.


OpenPCR program

HEATED​ ​LID:​ ​100°C

INITIAL​ ​STEP:​ ​95°C​ ​for​ ​2​ ​minutes

NUMBER​ ​OF​ ​CYCLES:​ ​25

Denature​ ​at​ ​95°C​ ​for​ ​30​ ​seconds,​ ​Anneal​ ​at​ ​57°C​ ​for​ ​30​ ​seconds,​ ​and Extend​ ​at​ ​72°C​ ​for​ ​30​ ​seconds

FINAL​ ​STEP:​ ​72°C​ ​for​ ​2​ ​minutes

FINAL​ ​HOLD:​ ​4°C




Research and Development

PCR - The Underlying Technology

There are 4 main components of a PCR reaction: template DNA, primers, Taq polymerase, and dNTPs. The template DNA is the dsDNA you are that contains the sequence you are intending to amplify. Primers are short strands of DNA made in the lab. They can have any sequence of nucleotides necessary to complement the regions flanking the part of the template DNA you are interested in amplifying. Taq polymerase is the enzyme that adds nucleotides one at a time to the 3' OH groups of a DNA strand, complementary to the template strand. dNTPs are the building blocks of DNA that are used to extend DNA strands in PCR.

PCR begins with an initial denaturation at 95 degrees C for 30 seconds, to begin to denature the dsDNA into 2 strands. Then a cycle of denaturation, annealing, and extension repeats for the desired number of cycles to achieve optimal amplification. This cycle includes denaturation at ​95°C​ ​for​ ​30 seconds, which separates dsDNA strands, annealing ​at​ ​57°C​ ​for​ ​30​ ​seconds, during which primers anneal to dsDNA, and extension​​ ​at​ ​72°C​ ​for​ ​30​ ​seconds, during which Taq polymerase extends the primers using available dNTPs in solution. Finally, after the desired number of cycles, the reaction is held at ​72°C​ ​for​ ​2 minutes, to ensure that the ssDNA is fully extended by Taq polymerase (this is the optimal temperature for Taq pol to work). Finally, the products can be stored in the short-term at​ ​4°C.

Base pairing thus occurs during the annealing and extension steps. During annealing, the primers anneal to ssDNA through complementary base pairing. During extension, dNTPs from solution are base paired by Taq polymerase to the template strand, extending off of the 3' OH group from the strand begun by the primer. A pairs to T and G pairs to C.




SNP Information & Primer Design

Background: About the Disease SNP

A nucleotide is a basic building-block of DNA, made up of a nucleotide attached to a phosphate group. A polymorphism is a genetic variation, such as a differing nucleotide between two individuals. We spent this lab investigating the SNP rs769452​​, which is found in Homo sapiens, and located on chromosome 19 (19:44907853). This SNP is pathogenic, and is associated with Alzheimer's disease. It is a SNP on the apolipoprotein E (APOE) gene. APOE codes for a protein that is amyloid-beta binding and has antioxidant activity. An allele is a specific form of a gene found at a certain location on a chromosome, of which there are multiple, distinguished by mutations. The disease-associated allele contains the codon CCG, while the non-disease allele contains the codon CTG.


Primer Design and Testing

The numerical position of the SNP is 44907853. Our non-disease forward primer, which we made from the sequence 20 bases long that ends with the nucleotide at the position of our SNP, is 5’ AGCGGCCAGCGCTGGGAACT 3’. Our non-disease reverse primer begins at position 44908053: 5’ CAGGCCCCCCAAGACTTAGC 3’

Error creating thumbnail: File missing


Our disease-specific primers are as follows. Forward: 5’ AGCGGCCAGCGCTGGGAACC3’ Reverse: 5’ CAGGCCCCCCAAGACTTAGC 3’


Error creating thumbnail: File missing