BME100 f2017:Group3 W0800 L4

From OpenWetWare
Jump to navigationJump to search
Owwnotebook icon.png BME 100 Fall 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png


OUR TEAM

Name: Maximo Gutierrez
Role(s)
Name: Maria Soldevilla
Role(s)
Name: Isaac Heath
Role(s)
Name: Camryn Garza
Role(s)

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA Polymerase, MgCl2, and dNTP’s
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G3 + Positive control none
G3 - Negative control none
G3 1-1 Patient 1, replicate 1 11603
G3 1-2 Patient 1, replicate 2 11603
G3 1-3 Patient 1, replicate 3 11603
G3 2-1 Patient 2, replicate 1 74627
G3 2-2 Patient 2, replicate 2 74627
G3 2-3 Patient 2, replicate 3 74627


DNA Sample Set-up Procedure

  1. Label each PCR tube according to DNA samples.
  2. Put the Positive Control DNA sample into the PCR tube labeled G3+ using a micropipette.
  3. Transfer the negative DNA sample to PCR tube labeled G3- with a new micropipette.
  4. Insert the Patient 1 sample into the test tubes labeled G3 1-1, G3 1-2, and G3 1-3.
  5. Insert the Patient 2 sample into the test tubes labeled G3 2-1, G3 2-2, and G3 2-3.
  6. Add the PCR Reaction Mix to each test tube using a clean micropipette for each test tube.
  7. Place the PCR test tubes into the Open PCR machine.
  8. Start the Open PCR machine and run for 25 cycles.


OpenPCR program

  • HEATED LID: 100°C
  • INITIAL STEP: 95°C for 2 minutes
  • NUMBER OF CYCLES: 25
  • Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
  • Extend at 72°C for 30 seconds
  • FINAL STEP: 72°C for 2 minutes
  • FINAL HOLD: 4°C



Research and Development

PCR - The Underlying Technology

Components in a PCR Reaction
Each component in a PCR has a specific function that helps the reaction to move along smoothly. The first piece of DNA used to create complementary strands of DNA is referred to as template DNA. Primers are single-stranded DNA molecules that are designed to amplify the desired DNA fragment in the solution that is present in PCR. They provide a 3' end for the DNA polymerase and also prevent separated DNA strands from recombining. TAQ Polymerase is an enzyme that, at higher temperatures (90 degrees Celsius plus), can replace DNA polymerase that has broken down due to high temperature. Single units of nucleotides (A,G,T,C) that are the building blocks for new strands of DNA are called Deoxyribonucleotides (dNTP’s). All of these components are pertinent to the success of a PCR Reaction.


Steps of Thermal Cycling
Throughout the process of thermal cycling, the DNA undergoes many different changes. During the initial step, the DNA is heated to 95°C for two minutes and almost reaches its boiling point. The first DNA double helix separates forming two single-stranded DNA molecules during denaturing at 95°C for 30 seconds. Next, the two primers attach to a strand of DNA before the strands can recombine. This annealing happens at 57°C for 30 seconds. The DNA is extended at 72°C for 30 seconds as the DNA polymerase attaches to the primer and the DNA strands where it then adds complementary nucleotides to the already existing ones. Finally, at 72°C for two minutes, the bond between the combined two strands becomes stable and the DNA is left to cool at a temperature of 4°C.


Important to Note
Four different nucleotides, Adenine, Guanine, Thymine, and Cytosine, make up DNA. Adenine and Thymine are paired through double hydrogen bonds, and Guanine is paired with Cytosine through a triple hydrogen bond. Base-pairing occurs during the annealing and extension stages of thermal cycling. During annealing, the temperature lowers to 57℃ so that short DNA primers bind to single-stranded DNA in certain locations. During the extension stage, the temperature rises to 72℃ where the presence of two Taq polymerase's prompts the process of base-pairing. A complementary strand is created when the Taq polymerase attaches to the primer and includes DNA bases through base pairing.



SNP Information & Primer Design

Background: About the Disease SNP

Single-Nucleotide Polymorphisms (SNPs) are the most common type of genetic variation present in humans. Representing a different in a single nucleotide within DNA, SNPs occur fairly normally throughout the human genome and are most commonly found in the DNA between different genes. More often than not, SNPs have no effect on health or development; however, researchers have found SNPs that could help predict someone's response to certain drugs, susceptibility to things like toxins, and risk of developing particular diseases. Lastly, SNPs can be used to track different gene down a family ancestry and are currently being explored further to identify more serious diseases.


Primer Design and Testing

The position of the SNP is 44907853. The non-disease reverse primer begins at 44908053.

Here are the primers for the non-disease.

Forward- 5’ AGCGGCCAGCGCTGGGAACT 3’

Reverse- 5’ CAGGCCCCCCAAGACTTAGC 3’

AHprimers1.png


Here are the primers for the disease.

Forward- 5’ AGCGGCCAGCGCTGGGAACC3’

Reverse- 5’ CAGGCCCCCCAAGACTTAGC 3’

AHprimers2.png